Técnicas de manipulación social y control de las flame wars

En la jerga informática una flame war se produce cuando un grupo de usuarios se enzarzan en una discusión acalorada e improductiva a través de un medio de comunicación digital. Las flame wars son tan antiguas como la propia Internet, segun Wikipedia, la edición de 1983 del Diccionario del Hacker ya contenía una definición del flaming. Según muchos psicólogos, las flame wars son un suceso seguro tarde o temprano cuando un grupo de gente no habla cara a cara. Pero las flame wars provocan enfados intensos en algunos usuarios y, lo que es peor (para el proveedor) bajas masivas en el servicio.

En este post voy a repasar cómo el flaming ha evolucionado según han ido apareciendo nuevas herramientas y, asimismo, qué técnicas para prevenirlo se emplean en la actualidad.

Fundamentos y tipos de flaming

La inevitabilidad del flaming se fundamenta en tres factores:

1º) Un fenómeno conocido cómo la Tragedia de los Comunes, que se produce cuando un grupo de personas comparten un recurso pero existen incentivos individuales para abusar del recurso. En el caso de la flame wars el recurso compartido es la atención del resto de los usuarios que los individuos tratan de acaparar generando escándalo.

2º) Es sabido que la persona que escribe tiende a dar por sentado que se entenderá el tono del mensaje que ha escrito. Mientras que la persona que lee tiende a interpretar el mensaje según su propio estado de ánimo. Entonces los malentendidos son frecuentes. Tan frecuentes, de hecho, que por eso hubo que inventar los emoticonos para aclarar con nuevos signos de puntuación la emoción contenida en el mensaja.

3º) No es necesario que todos los usuarios malinterpreten el mensaje o estén enfadados. Basta con que uno de ellos sea un sociópata que eche la colilla al monte para que se produzca un incendio. En un grupo suficientemente numeroso de personas siempre habrá al menos una deseosa de iniciar una gresca y al menos otra deseosa de continuarla.

Además de por ansia de atención, deficiente interpretación y trastornos mentales; yo añadiría, y esto es sólo una opinión personal, que el flaming se puede iniciar por la cantidadd de tiempo que transcurre entre que reaccionamos emocionalmente a algo y conseguimos pensar acerca de ello racionalmente. Sucede que la parte más primitiva de nuestro cerebro, que genera las emociones primarias, funciona a mayor velocidad que el neocórtex. La diferencia, según tengo entendido, es de unos pocos milisegundos. Pero suficiente para provocar que las personas sienten antes de pensar. A veces esta emoción inicial nubla el buen juicio y es a partir de ese momento que empieza la escalada de violencia verbal.

Y más aún, algunos de los documentos filtrados por E. Snowden, pusieron de manifiesto que los gobiernos británicos y estadounidense atacan a sus enemigos con técnicas de desinformación que comentaré más adelante.

Según los psicólogos, existen básicamente cuatro tipos de hostilidad online: el desprecio, el despecho, el asalto y el linchamiento. El desprecio directo es típicamente una forma de agresión masculina, y el despecho a través de rumores es típicamente femenino. El asalto se produce cuando un grupo se organiza para atacar un objetivo, como por ejemplo hacen los hackers de Anonymous. El linchamiento se produce cuando el grupo etiqueta a un transgresor y apoya cualquier barbaridad de una cruzada organizada contra él. Esta distinción está bien, pero a mi me parece que en esencia todos los tipos son lo mismo: quedarse sin argumentos razonables durante una conversación y recurrir al insulto como medio para continuar la disputa.

Primera generación de herramientas de social media

Los primeros medios donde apareció el flaming fueron las listas de correo y los foros. En ellos es frecuente que se produzcan flame wars. Lo primero que se instauró para poner coto a las flame wars fueron las reglas de netiqueta. El problema con la netiqueta es que, al no ser forzosamente obligatoria, los que más la deberían cumplir son precisamente los que menos uso hacen de ella. A lo largo de los años se experimentó con diversas técnicas para prevenir el flaming en las listas de correo como, por ejemplo, limitar la cantidad de mennsajes que cada usuario puede publicar por unidad de tiempo de modo que tenga que esperar cada vez más antes de responder. Sin embargo, lo más eficaz, según los propietarios de las listas, es contactar directamente y privadamente con el troll y pedirle que pare. Privar al troll de su objetivo principal, la audiencia, es la mejor forma de que cese en su actitud. El problema es la cantidad de tiempo y esfuerzo que se requiere para contactar uno por uno a todos los incumbentes y pedirles que haya paz. El resultado es que a día de hoy las listas de correo y los foros siguen siendo vulnerables al flaming y en parte por eso están en desuso.

Segunda generación de herramientas de social media

Tras las listas de correo y los foros, surgieron los weblogs y los wikis. En los weblogs es más fácil prevenir el flaming porque existe un “amo del calabozo” propietario del weblog que puede aprobar o rechazar comentarios antes de que se publiquen, los cuales, además, suelen estar separados del artículo principal, de forma poco visible. En los wikis lo que sucede es que, gracias al control de revisiones, deshacer cambios es mucho más fácil que hacerlos. Entonces, aunque Wikipedia ha sufrido innumerables intentos de manipulación y tergiversación hasta el punto de tener que restringir la edición de algunas páginas, a la postre ha conseguido sobrevivir como una fuente creible de información gracias a la constante supervisión grupal de la veracidad de los contenidos.

Tercera generación de herramientas de social media

El primer medio que popularizó una novedad significativa en el control del flaming fue Slashdot (en versión española Menéame). En Slashdot cada vez que un usuario comparte un contenido el resto le votan y adquiere “karma” (positivo o negativo). Las noticias más votadas aparecen primero y la credibilidad de un usuario depende de su buen karma. Además se introdujo un grupo de moderadores (usuarios con gran karma) y un grupo de meta-moderadores (moderadores de los moderadores). Esto funcionó bastante bien, y aunque tanto en Slashdot cómo en Menéame todavía pueden encontrarse verdaderos regueros de comentarios mierdosos, su visibilidad es enormemente reducida y normalmente no molestan. El siguiente refinamiento sobre Slashdot fue StackExchange. En StackExchange existen reglas bastante sofisticadas para regular el karma. Las ganancias y pérdidas son asimétricas. Se ganan diez puntos de karma cuando se recibe un voto favorable de otro usuario, pero sólo se pierde un punto de karma por cada punto desfavorable. Además, cuando se vota en contra de otro usuario se resta un punto también a tu propio karma. Es decir, al votar en contra de otro votas también en contra de ti mismo. El efecto de esto es que sólo los usuario con buen karma para gastar pueden hundir la reputación de otros. También se pueden ofrecer botines por publicar respuestas brillante. Y existe un extenso conjunto de diferentes medallas (badges) que se pueden ganar además de la cifra numérica de karma. El problema de los sitios como Slashdot y StackExchange (a mi juicio) es que cuesta mucho tiempo y esfuerzo ganar el karma. Una persona puede haber ganado la Medalla Fields, sin embargo, cuando se registre en MathOverflow (uno de los sitios de StackExchange) no tendrá ningún karma, y además, tendrá que pasarse cientos de horas en MathOverflow para poder obtener una cantidad significativa de karma. Entonces más que un grupo de expertos, lo que se genera es un grupo de usuarios fanáticos yonkis del karma cuya especialidad no es inventar nada sino investigar lo que otros han inventado para responder a las preguntas de los que no tienen ni idea.

Cuarta generación de herramientas de social media

Una importante limitación de Slashdot y StackExchange es el poder de las élites. En este tipo de redes el 10% de los usuarios genera el 90% de los contenidos. Había de alguna forma que democratizar la participación pero sin que se llenase la conversación de basura. A mi me gusta bromear argumentando que Facebook es la democratización de la prensa rosa. Antaño la gente compraba masivamente la revista Hola, pero sólo unos poquísimos podían salir en las páginas de Hola. La misión, pues, era que cualquiera pudiese salir en Hola, pero sin evitar que la participación masiva lo convirtiese en un folletín de prensa amarilla lleno de polémica.

Creo que lo primero que hay que tener en cuenta sobre Facebook es que, aparentemente, no está interesado en manipular la opinión pública, sino que su objetivo es recopilar información de los usuarios para vendérsela a los anunciantes y generar tráfico manteniendo a la audiencia enganchada. Lo que los investigadores de Facebook descubrieron en un polémico estudio secreto es que la lealtad de un usuario a un sitio depende del estado emocional que el sitio le genere, y, además, las emociones son contagiosas entre usuarios. Por consiguiente, para que los usuarios vuelvan es menester que no se enfaden y para que no se enfaden no deben poder leer nada ofensivo. La vida perenne dentro de lo políticamente correcto la genera Facebook de varias maneras. Lo primero que hicieron en Facebook fue desestimar el karma y los votos negativos estilo Slashdot porque se descubrió que la popularidad comparativa afectaba emocionalmente a muchos usuarios, especialmente a las féminas adolescentes. Es por eso que no existe el botón de No me gusta 👎 En segundo lugar, Facebook otorga al propietario de cada muro el poder de eliminar comentarios, borrar de la lista de amigos o prohibir la publicación a cualquier indeseable. Es decir, el propietario de la conversación es siempre el que la inició y no se permiten comentarios críticos. Adicionalmente, no se pueden ocultar a los amigos los clicks en Me gusta de páginas públicas. Eso desincentiva a la gente a aumentar la popularidad de nada que esté socialmente mal visto. El algoritmo de recomendaciones introduce un importante sesgo de confirmación sugiriendo al usuario sólo cosas relacionadas con aquello a lo que dijo “Me gusta”. Si te preocupa el cambio climático y usas Facebook acabarás creyendo que el futuro de la Humanidad depende de que salvemos a las ballenas, y si tienes un perro y usas Facebook acabarás pensando que los derechos de los animales están por encima de los derechos humanos. Da igual cómo empieces, Facebook lo único que hará será reforzar y radicalizar más y más cualquier idea semilla que le introduzcas. El mecanismo psicológico detrás de este refuerzo es que para entender algo primero necesitamos creer en ello. Por ejemplo, nadie entendió que la Tierra podría girar alrededor del Sol, y no al revés, hasta que alguien creyó que tal órbita era realmente posible. Por último, y por si todo lo anterior fuese poco, cada día crece la cantidad de cuentas de Facebook y Twitter que tienen una segunda cuenta de respaldo en previsión de que les cierren la primera por censura. Y de Tumblr ya ni hablemos, pues en Tumblr una cuenta dura viva menos que un caramelo en la puerta de un colegio.

Cómo se manipula y sabotea la opinión pública

Existen varias decenas de técnicas bien conocidas para manipular y sabotear la opinión pública. Las 25 Reglas de la Desinformación de Michael Sweeney o Desinformación: Cómo funciona de Brandon Smith son un par de buenos ejemplos recopilatorios de las tácticas entre las cuales, a mi juicio, algunas de las principales son:

1. Divide y vencerás. Se trata de enfrentar a unos grupos opositores contra otros. Esto se puede conseguir acentuándo sus diferencias para menguar su fuerza combinada contra un adversario común. Pero también de formas más sutiles. Por ejemplo, proponiendo soluciones exageradas y fuera de lugar.

2. Ruptura de consenso. Consiste en publicar un argumento aparentemente sólido con una cuenta falsa. Luego, con otras cuentas falsas, demostrar que se trata de un argumento totalmente falaz.

3. Dilución del asunto. Se consigue publicando sistemáticamente contenidos no relacionados con el tema que se desea evitar.

4. Exigencia de pruebas irrefutables. En las conversaciones, usar la presución de inocencia para exigir pruebas absolutamente irrefutables de todo. Por muchos indicios que haya y muy verosimil que sea la historia, tacharla de falsa invalidando las pruebas y alegando que se trata sólo de una conspiración malintencionada.

5. Desacreditación de la fuente. Si la fuente es un blogger independiente, argumentar que su opinión no tiene ningún periodístico y que sólo se trata de un charlatán tratando de ganarse el favor de algunos poderosos. Si la fuente es un gran medio de comunicación, argumentar que todos los periodista y el editor están en la nómina de alguien quien decide lo que se publica o no. Si el autor no ostenta un posdoctorado, decir que su opinión no vale nada, si lo ostenta decir que nunca ha salido de la universidad y no conoce el mundo real.

Creo también que vale la pena mencionar, como contraejemplo, el fracaso estrepitoso de las técnicas basadas en descalificar personalmente al adversario. No funcionaron contra Winston Churchill, no funcionaron contra Vladimir Putin, no funcionaron contra Donald Trump y en España no funcionaron contra Mariano Rajoy. El estudio del odio exacerbado de los progres contra Donald Trump creo que merecería un libro entero. Primero por lo contrproducente de la estrategia y segundo por la sorprendente forma en la cual, después de haber denostado a Trump de todas las formas imaginables, los atacantes se han empezado a victimizar como si los seguidores de Trump hubiesen organizado una caza de brujas en la red contra sus detractores.

Post relacionados:
Propaganda 2.0.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Usos sociales de la tecnología | Deja un comentario

Cómo sobrevivir a las estimaciones de software

Una de las preguntas mas peliagudas que un desarrollador tiene que responder semanalmente es “¿cuanto vas a tardar en hacer esto?” Que es muy probablemente lo que le preguntó el papa Julio II a Miguel Ángel cuando le encargó decorar la bóveda de la Capilla Sixtina.
Existen diversas técnicas formales de estimación, las que funcionan están basadas en apuntar cuánto se tardó realmente en realizar una tarea similar en el pasado y estimar que se tardará mas o menos lo mismo en completar la nueva tarea. Para el desarrollo en territorio desconocido existen también varios métodos especulativos incluidos algunos tan divertidos como el planning poker donde los programadores realmente apuestan cuánto van a tardar.

Dilbert Software Estimation

No repasaré los métodos cuantitativos, que dan de si como para un libro entero de ingeniería de software. Aunque cualquiera que trabaje en un proyecto de software debería como mínimo conocer cuatro cosas:

1) los fundamentos del modelo COCOMO y el Software-Engineering-Economics de Boehm.
2) cómo funcionan las historias de usuario y los product backlogs en Agile, sobre lo que hay una breve introducción aqui y más extensamente en el libro de Mike Cohn.
3) qué es PERT y CPM.
4) cuales son las tecnicas de optimización global.

Otro libro recomendable es Software Estimation: Demystifying the Black Art.

Me voy a centrar en las estimaciones que no queda más remedio que sacar de un sombrero.

La primera pregunta que hay que hacer en respuesta a la pregunta “¿Cuánto vas a tardar en hacer esto?” es “¿Para qué quieres saberlo?”.

Normalmente se quiere saber porque el tiempo esta asociado al consumo de recursos o a una fecha de compromiso con el cliente. Pero no es lo mismo una cosa que la otra. Quizá el consumo de recursos sea flexible porque se puede pedir más dinero a los inversores pero la fecha de compromiso con el cliente no sea nada flexible porque hay que contratar una campaña de publicidad en televisión, anunciando la nueva web, cuya programación no se puede cambiar de ninguna manera una vez acordada con la cadena emisora. O puede que la fecha sea necesaria porque hay que asignar recursos en otro departamento que está a la espera de recibir el nuevo software.

Es decir, lo primero que hay que hacer es determinar el ámbito del problema y la precisión que debe tener la estimación.

Lo siguiente que hay que hacer es una lista de pre-requisitos para que la estimación sea válida. Por ejemplo, puede que la resolución implique revisar un código antiguo que nadie conoce bien y que quizá no se pueda modificar alegremente, o puede que solucionar un defecto en el diseño de la base de datos requiera unos privilegios de administración otorgados por un tercero que puede tardar un tiempo indeterminado en despachar un ticket de soporte. En general, la causa mas común de retrasos en equipos Agile es que se esté esperando a algo que debe ser proporcionado por una fuente externa que no es Agile, entonces el equipo se convierte en un grupo de personas esperando “eficientemente” a que alguien más haga algo. Es importante que el cliente entienda y acepte los pre-requisitos.

Una vez acotado el ámbito del problema y la precisión requerida y acordados los pre-requisitos, lo siguiente es decir: “No sé cuánto tardaremos, pero lo sabré dentro de X horas/dias”. Explicando que se necesita tiempo para evaluar detenidamente la información disponible antes de poder hacer una estimación. Si el cliente insiste en este punto en obtener una estimación una respuesta posible es: “La media entre dos horas y dos meses, dependiendo de lo que nos encontremos durante el análisis detallado del problema”.

No obstante lo anterior, si el responsable de la planificación de proyecto no esta presente en la reunión, hay sólo tres respuestas que un programador debe dar a cualquier petición de estimación:

a) “Es imposible hacer eso”.
b) “Es extraordinariamente difícil y peligroso hacer eso”.
c) “Eso debemos hablarlo con el jefe de proyecto”.

A veces hay que educar a los usuarios porque no conocen el proceso de desarrollo. A veces no entienden que aunque una madre haga un niño en nueve meses, dos madres no pueden hacer un niño en cuatro meses y medio. Otras veces no entienden que sólo es posible fijar dos de los tres lados de triangulo coste/calidad/tiempo. Y en otras tienen problemas para priorizar por el método MoSCoW (Must have, Should have, Could have, Won’t have). Si este es el caso, es muy conveniente hacerle saber al cliente que un software grandioso es aquel que hace unas pocas extraordinariamente bien y no aquel software que sirve para todo pero no es bueno para nada.

En el caso de que no quede ningún otro remedio que responder, puede ser útil aplicar el Principio de Scotty que consiste básicamente en estimar a ojo de buen cubero, añadir un 50% de tiempo a la estimación y reportar la cifra inflada. Aunque una nota de aviso sobre esto: funciona para dar estimaciones al cliente final, pero no para hacer estimaciones internamente en el equipo de desarrollo. Esto es debido a que si se permite que los desarrolladores estimen unilateralmente cuando terminarán el software, entonces nunca lo terminarán porque, por su propia naturaleza, un software nunca esta terminado.

Si se ha fallado en las estimaciones previas la credibilidad estará en entredicho. En tal caso lo mejor es suponer que las siguientes estimaciones se desviarán en la misma medida en que se desviaron las anteriores. De hecho, esta capacidad de extrapolación es presuntamente una de las ventajas de Agile. Si se estimó que una tarea al inicio del proyecto tardaría dos dias y tardó realmente cuatro entonces es posible conjeturar desde casi el principio que todo el proyecto tardará el doble de tiempo del inicialmente estimado. Si el proyecto pinta mal entonces “más vale ponerse una vez (muy) colorado que ciento amarillo”. En un proyecto que requiere reingeniería hay que resistir a muerte y cueste lo que cueste las presiones para dar fechas optimistas. Esto no siempre es fácil porque lo habitual es hacer rodar la cabeza del responsable de desarrollo que incumplió sistemáticamente los plazos y substituirlo por otro que promete que si puede cumplirlos. Y luego decapitar a este segundo también y a todos sus sucesores hasta que el proyecto se completa o se cancela.

Por ultimo, si no se tiene realmente ninguna idea y hay forzosamente que responder, entonces decir “dos semanas”, que es lo que dura como mínimo un sprint y lo que se tarda en hacer circular el curriculum actualizado.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Casos Prácticos | Deja un comentario

Estado del arte de la genómica computacional

Codigo GenéticoLa bioinformática es el área de la computación que tiene mayor potencial para transformar el estado de la Humanidad a corto-medio plazo. Es escasamente comentada por los medios de comunicación, probablemente debido a la inexistencia de productos de consumo masivo con fuertes inversiones en campañas de publicidad y relaciones públicas.

Cuando se habla de bioinformática se piensa casi siempre en la secuenciación de ADN. Pero los desafíos científicos de la bioinformática no se limitan a la manipulación del código genético, sino que abarcan otras áreas como la predicción de estructura y alineamiento estructural de proteínas, el modelado de procesos evolutivos y, en general, la explicación de todos los procesos biológicos.

En este artículo voy a comentar sólo la genómica computacional, es decir, el estado del arte de la tecnología para tratamiento informatizado del código genético usando técnicas algorítmicas, estadísticas, y “Big Data”. Pero el desafío científico es mucho más amplio e incluye:

• Cómo leer rápidamente, con exactitud y a bajo coste el ADN de un organismo vivo.
• Cómo almacenar las secuencias de ADN leídas.
• Cómo comparar nuevas secuencias con secuencias ya conocidas para establecer relaciones evolutivas entre ellas o encontrar mutaciones patógenas.
• Cómo explicar la síntesis de proteínas, crecimiento de tejidos, formación de órganos, coordinación entre órganosy otros procesos vitales con un lenguaje de alto nivel que nos permita describir organismos vivos.
• Cómo crear cadenas de ADN y cromosomas ensamblando genes que cumplan una determinada función.
• Cómo insertar el ADN generado en una célula capáz de producir la función especificada.
• Cómo alterar los genes ya presentes en un organismo vivo para corregir errores y curar enfermedades.

Es frecuente asociar la genómica computacional con el diagnóstico y tratamiento de trastornos de salud cuyo origen es genético, pero la genómica computacional es aplicable a muchas más cosas además de la medicina. Quienes están invirtiendo activamente en la recopilación y explotación de información genética tienen en mente un uso comercial mucho mayor. Actualmente aún es relativamente caro secuenciar ADN, pero llegará un día no muy lejano en el que las empresas paguen por tener nuestra información genética con el fin de usarla para personalizar su oferta, no sólo en forma de medicamentos a la medida del paciente, sino en base a cualquier cosa que el ADN pueda revelar acerca de las preferencias y necesidades de cada persona.

Como en ocasiones anteriores, he estructurado el texto desde lo menos técnico a lo más técnico. Necesito empezar explicando un poco el contexto de qué es el ADN y cómo funciona antes de poder comentar los métodos computacionales. Finalmente explicaré el hardware y otras tecnologías que se usan modernamente para la implementación.

Composición y estructura del ADN

Desde el punto de vista de el tratamiento de información, las cadenas de ADN son básicamente un lenguaje que explica cómo se sintetizan proteínas a partir de veinte aminoácidos constituyentes. El orden en el que se concatenan los aminoácidos determina la estructura de la proteína (que puede llegar a ser bastante compleja) y la estructura determina su función. Las proteínas sintetizadas forman células, las células forman tejidos, los tejidos forman órganos y los órganos cooperan para hacer funcionar el cuerpo humano.

Secuencia AT-CGLas cadenas de ADN se forman con cuatro nucleótidos: dos purinas, adenina (A) y guanina (G) ; y dos pirimidinas, citosina (C) y tiamina (T). En adelante nos referiremos a estos nucleótidos simplemente como A G C T. Los nucleótidos se enlazan siempre en los mismos pares purina-pirimidina A-T y C-G dentro de la conocida estructura de doble hélice. Cada triplete de nucleótidos forma un codón. Un codón codifica un aminoácido. Hay 64 codones posibles, pero sólo 20 aminoácidos. Un aminoácido puede ser codificado por 1,2,3,4 o 6 codones distintos. También existe un codón de inicio y tres codones de terminación. Por ejemplo, la secuencia que da nombre a la película GATTACA podría interpretarse como GAT TAC A en cuyo caso codificaría ácido aspártico seguido de tirosina más una A extra; o como G ATT ACA y entonces sería una G seguida de isoleucina y treonina.

Animaciones de biología invisible

Animaciones de biología invisible, Drew Berry

Las secuencias de codones forman exones e intrones que intercalados forman un gen. Durante mucho tiempo el dogma central de la genómica fué que un gen codifica una proteína aunque no es exactamente así. Los intrones pueden dotar al gen de empalmes alternativos que le sirven para generar diferentes proteínas relacionadas. Durante el proceso de transcripción, se eliminan los intrones y se empalman los exones del gen antes de empezar el proceso de síntesis protéica. Se estima que los humanos tienen unos 19.000 genes codificadores de proteinas, además, cada gen puede codificar variantes de la misma proteina por lo que se estima que en los humanos pueden existir hasta 100.000 proteínas diferentes.

ADN intrones y exones
Un grupo de genes capaces de ejercer una regulación de su propia expresión por medio de los sustratos con los que interactúan las proteínas codificadas forma una unidad genética denominada operón. Cada operón tiene tres partes: el factor promotor, el operador y el gen regulador en cuyos detalles no entraremos aquí.

Además del orden de la secuencia de nucleótidos, los hallazgos científicos recientes confirman que la forma en la que está plegado el ADN también es relevante para su funcionalidad. El genoma humano completo tiene unos 3.000 millones de pares de nucleótidos repartidos en 23 cromosomas. Puesto en línea mediría aproximadamente dos metros. Sin embargo, cabe dentro de los 10 micrometros del núcleo de cada célula porque está retorcido en nucleosomas. De la expresión de los genes que no depende de la secuencia sino de su plegamiento y otros factores se ocupa una rama llamada epigenética.

Hasta aquí lo que tenemos es una maquinaria de producción de proteínas y autoreplicación. Pero el ADN no puede ser sólo una superestructura molecular autoreplicante y generadora de proteínas. Tiene que ser algo más. El ADN debe poseer las cinco características de todo lenguaje: alfabeto, gramática, significado, intención y redundancia y corrección de errores.

Por poner sólo uno de los innumerables ejemplos que podríamos encontrar. Durante la reproducción los espermatozoides encuentran el óvulo debido a que éste emite calcio. Los espermatozoides pueden detectar el gradiente de calcio y nadar en la dirección en que aumenta la concentración. Este comportamiento tan complejo de una sola célula no puede explicarse sólo en términos de síntesis protéica. Tiene que existir algo más en el ADN que controle cómo nadan los espermatozoides.

Técnicas de secuenciación de ADN

Como síntesis del análisis anterior sobre la composición y estructura del ADN podemos decir que en los humanos encontramos tres mil millones de bits (nucleótidos) agrupados en palabras de 3 bits (codones) que componen subrutinas (genes) contenidas en módulos (operones). Pero por ahora nadie sabe cómo proporcionar una explicación de alto nivel a cómo interpretar este galimatías.

Secuenciación por perdigonadaEl primer desafío es secuenciar el ADN. No se conoce ninguna técnica para leer un cromosoma de principio a fin. Lo que se hace actualmente se conoce como secuenciación por perdigonada seguida de un ensamblado de secuencias. Esta técnica consiste en cortar múltiples copias del ADN a secuenciar en múltiples fragmentos de una longuitud variable entre 600 y 800 nucleótidos. Luego averiguar cómo encjan unos fragmentos con otros casando el final de un fragmento con el principio de todos los otros maximizando el grado de solapamiento de nucleótidos.

Secuencia original AGCATGCTGCAGTCATGCTTAGGCTA
Primera perdigonada AGCATGCTGCAGTCATGCT——-
——————-TAGGCTA
Segunda perdigonada AGCATG——————–
——CTGCAGTCATGCTTAGGCTA
Secuencia reconstruida AGCATGCTGCAGTCATGCTTAGGCTA

Para complicar aún más el proceso, ningún secuenciador de ADN proporciona lecturas correctas con un 100% de probabilidad. Cada nucleótido es leído sólo con un porcentaje de probabilidad. Aunque con los secuenciadores más modernos y múltiples lecturas con consenso la probabilidad llega al 99,9%.

Similitud de secuencias de ADN

La variación genética entre humanos se estima que es entre el 0,1% y el 0,4% de los nucleótidos. Es decir, entre el ADN de dos humanos cualesquiera difiere, más o menos, en uno de cada mil nucleótidos. Cuando se secuenció el genoma humano por primera vez no se hizo con el ADN de un sólo individuo sino con el de cinco individuos. Estudios posteriores con 1.000 individuos de 26 poblaciones diferentes han mostrado que existen entre 4,1 y 5 millones de diferencias con el genoma de referencia. Debido a que, como ya hemos expuesto, dos codones diferentes pueden codificar el mismo aminoácido, muchas de estas variaciones son irrelevantes. Pero otras pueden causar graves enfermedades sólo por la variación de un nucleótido que imposibilita la síntesis de una proteína esencial para algún proceso vital.

Según las cifras que hemos indicado, los algoritmos de detección de disfunciones de origen genético deben buscar en unos tres millones de diferencias repartidos entre tres mil millones de pares.

Lo primero que se necesita pues es una métrica de similitud de secuencias. En genómica la similitud de secuencias de nucleótidos se mide comparando alineamientos. Para poder realizar un alineamiento de dos secuencias primero deben tener la misma longitud pues de otro modo no es posible hablar de los nucleótidos en la posición 1, 2 etc. Si dos secuencias no tienen la misma longuitud entonces se pueden insertar espacios al principio, al final o en medio de cada secuencia. Los espacios se conocen en la jerga genómica como “indels” (inner insertion or deletion) Por ejemplo, supongamos que empezamos con las secuencias GACTCT y GAGGC. Un posible alineamiento para ellas es:

GAC_TCT
GA_G_C_

Entonces una posible métrica es considerar el número de posiciones con el mismo nucleótido y restarle las posiciones con nucleótidos diferentes o con un espacio. En este caso las secuencias alineadas coinciden en los nucleótidos 1,2,6; difieren en la posición 3 y tienen espacios en 4,5,7. Por consiguiente, la puntuación para este alineamiento será 3-1-3 = -1. Tres coincidencias menos una no-coincidencia menos tres espacios. Con esta métrica, nuestra definición de lo que es el mejor alineamiento A posible de dos secuencias S₁ y S₂ será:

A ∋ A = MAX (#coincidencias – #nocoincidencias – #espacios)

Por supuesto esta sencilla métrica no es la única válida. Lo que se deseará es emplear una métrica que devuelva la máxima similutud para secuencias de nucleótidos que tengan la misma función biológica aunque las secuencias no sean idénticas nucleótido por nucleótido. Es posible otorgar diferente peso a las no-coincidencias y a los espacios. También es común el uso de mutaciones puntuales aceptadas, es decir, substituciones en nucleótidos que se sabe que no afectan significativamente a la función de la proteína descrita por un gen. Pero por ahora no entraremos en las matrices de substitución y nos centraremos en los algoritmos de alineamiento de secuencias.

Alineamiento de secuencias de ADN

Los algoritmos más populares para alineamiento de secuencias son el Needleman-Wunsch para alineamiento global, el Smith–Waterman y el Altschul-Erickson para el alineamiento local y BLAST o FASTA para búsquedas heurísticas. El Needleman-Wunsch sirve para comparar si dos genes tienen probablemnente la misma función. Las variantes de Smith–Waterman se emplean para buscar subsecuencias y para averiguar si el final de una secuencia encaja con el principio de otra tal y como requiere el ensamblado de fragmentos en la secuenciación por perdigonada. BLAST y FASTA se usan para buscar rápidamente en una base de datos secuencias potencialmente similares a una dada y con los resultados preliminares devueltos por la búsqueda heurística de BLAST se ejecuta Needleman-Wunsch para encontrar la secuencia conocida más similar.

Veamos porqué se necesitan algoritmos eficientes para encontrar el mejor alineamiento de dos secuencias. Sea r la diferencia de longuitud entre las dos secuencias S₁ y S₂. Por principios de combinatoria, el número de secuencias diferentes que es posible generar a partir de S₁ (de longitud n) con r espacios es :

C(n+r,n)

Dado que k! = 1×2×3×…k incluso para cadenas muy cortas, pongamos por ejemplo de 10 nucleótidos con 5 espacios, las variantes serían: (10+5)! ÷ 10! 5! = 3.003

Ahora hay que alinear la secuencia S₂ con S₁. Se puede comprobar que el número total de alineamientos posibles es:

∑ C(n+r,n) C(n,r)

Es decir ¡el numero de alineamientos posibles entre dos secuencias crece vertiginosamente rápido a medida que aumenta la longuitud de las mismas!

Afortunadamente, no es necesario generar y puntuar todos los alineamientos para encontrar el óptimo. El truco consiste en componer una matriz con las secuencias en los ejes de abcisas y ordenadas. Con dicha disposición de las secuencias, es posible demostrar que cada alineamiento posible se corresponde con un camino entre la esquina superior izquierda ✲ y la inferior derecha ✲. Para trazar estos caminos se puede recorrer la diagonal si los nucleótidos de la abcisa y la ordenada coinciden y si no coinciden se debe hacer un desplazamiento vertical u horizontal, lo cual equivale a insertar un espacio en una u otra secuencia. Cuando se puede recorrer la diagonal se suma 1 al camino que se está recorriendo y cuando hay que moverse verticalmente u horizontalmente se resta 1. El alineamiento (o alineamientos) óptimo según la métrica que hemos descrito anteriormente es aquel que tiene la diagonal más larga. En el caso del camino azúl de la matriz mostrada su puntuación será -1+1-1+1-1+1+1+1+1+1+1+1=6.

Alignment matrix

No voy a detallar aquí el algoritmo de programación dinámica basado en explorar el vecindario de cada nodo ┼ para trazar el camino y seguidamente reconstruir el alineamiento a partir del camino. Lo importante es que dicho algoritmo se puede ejecutar en un tiempo proporcional a 12×m×n, Siendo m y n la longuitud de las secuencias. Es decir, para dos secuencias de igual longuitud n la complejidad del algoritmo para alinearlas globalmente es O(n²) lo cual sigue siendo computacionalmente costoso pero es un tiempo polinómico en lugar de la horrenda expresión factorial.

El alineamiento global se usa para comparar genes. Incluso entre diferentes especies. Si identificamos un gen de ratón con una determinada función biológica (recordemos que un gen codifica una proteína) entonces podemos buscar un gen parecido en los humanos y si lo encontramos probablemente tendrá una función biológica en los humanos muy similar a la que tiene en los ratones.

Otro problema de alineamiento relacionado es que dadas dos secuencias S₁ y S₂ de longuitudes m y n, se desea encontrar dos subsecuencias de longitudes p y q tales que el valor de su alineamiento sea máximo. El algoritmo de Smith–Waterman para el alineamiento local es una variante del método de buscar la diagonal más larga excepto que permite empezar y terminar por nodos diferentes del superior izquierdo y el inferior derecho, y en un momento dado se puede descartar un conjunto de nodos ya explorados porque su puntuación sea negativa.

Respecto del ensamblado de secuencias cortas (entre 500 y 800 nucleótidos) para secuenciar genomas enteros con millones de pares de bases, buscar el mejor encaje entre el final de una secuencia y el principio de otra tomada de un conjunto de candidatas, es un problema muy similar a buscar un alineamiento global entre el final de una secuencia y el principio de otra excepto porque en este caso podemos esperar que el alineamiento, en el caso de existir, tenga muy pocas no coincidencias (debido a que las dos subsecuencias son trozos de la misma secuencia original) excepto porque se producen esporádicamente errores en la lectura de los nucleótidos. Con los secuenciadores modernos, la tasa de errores no supera el 0,1%, por consiguiente, el algoritmo deberá aplicar alguna técnica de corrección de errores y luego penalizar mucho las no-coincidencias.

Por último, puede presentarse el problema de encontrar el mejor alineamiento múltiple para una colección s de secuencias de longuitud n. La complejidad de este problema es O(ns) y, de hecho, se sabe que es un problema NP-Completo, por consiguiente, no existe ninguna solución que se pueda encontrar en tiempo polinómico. Sin embargo, el alineamiento de múltiples secuencias puede proporcionar información que es imposible de obtener con el alineamiento de sólo dos secuencias. Sucede que en regiones de ADN con funciones similares las partes de mayor importancia evolucionan con mayor lentitud que las partes menos relevantes biológicamente. Entonces es posible tomar, por ejemplo, secuencias de diferentes mamíferos, perros, gatos, ratones, humanos, etc. e identificar qué subsecuencias cambian (o no cambian) en operones que se sabe que cumplen funciones biológicas parecidas. Recíprocamente, si se tiene una secuencia que no se sabe para qué sirve pero puede alinearse de forma múltiple con otras secuencias de una colección que sí se sabe para qué sirven, entonces es posible concluir que la secuencia desconocida pertenece probablemente a la colección con la que tiene un buen alineamiento múltiple.

Una colección de secuencias relacionadas mediante un alineamiento múltiple se conoce como un perfil. Cuando se quiere saber si una nueva secuencia se ajusta a un determinado perfil, lo que se puede hacer es comparar el nucleótido en cada posición con los nucleótidos en la misma posición en el perfil, teniendo en cuenta que el perfil da una probabilidad para nucleótido A,T,C,G en la posición n. No obstante, existen otros métodos para determinar si una secuencia tiene un determinado perfil, en particular, los modelos de Markov que veremos a continuación.

Modelos de Markov

Resumidamente, un modelo de Markov consiste en un conjunto de estados y una probabilidad de transición de un estado a otro. Para el ADN tomaremos cuatro estados: A,T,C,G. A cada transición de un estado a otro A→A, A→T, A→C, A→G, T→A, T→T, etc. se le asigna una probabilidad. En este caso, si las transiciones de estado fuesen completamente aleatorias, la probabilidad de transición desde cada estado al siguiente sería ¼. Una secuencia de transiciones de estado contruida siguiendo las probabilidades de transición de un estado a otro se denomina una cadena de Markov. El generador puede representarse como un grafo dirigido con una probabilidad asociada a cada una de las aristas.

Grafo dirigido completo

Esto tiene varias aplicaciones en genómica. Sucede, por ejemplo, que las regiones CpG (un nucleótido C seguido de otro G) son raras excepto para indicar el comienzo de un gen, con una longitud de la región CpG desde cien a unos pocos miles de pares de bases.

Probabilidades de transición
en regiones CpG
.

A C G T
A .180 .274 .426 .120
C .171 .368 .274 .188
G .161 .339 .375 .125
T .079 .355 .384 .182
Probabilidades de transición
en regiones no CpG
.

A C G T
A .300 .205 .285 .210
C .322 .298 .078 .302
G .248 .246 .298 .208
T .177 .239 .292 .292
Fuente: Hidden Markov Model for CpG islands

Con estos datos es posible comparar la probabilidad de que una secuencia sea una región CpG versus una región no CpG. Para ello basta con multiplicar las probabilidades de transición. Por ejemplo, dada la secuencia CGACGT en cada modelo habría que multiplicar: C→G × G→A × A→C × C→G × G→T. Entonces la probabilidad de que CGACGT haya sido generada por el modelo CpG es 0,274 × 0,161 × 0,274 × 0,274 × 0,125 = 0,000414 y para el modelo no CpG es 0,078 × 0,248 × 0,300 × 0,078 × 0,208 = 0,000094. Es decir, es cuatro veces más probable que la secuencia CGACGT pertenezca a una región CpG que a una región no CpG.

Llegados a este punto, es fácil intuir que dada una secuencia querremos hallar el Modelo de Markov Oculto que la generó. Es decir, la Cadena de Markov que con una mayor probabilidad generará la secuencia que ya tenemos. Esto se hace con el algoritmo de Viterbi, otro algoritmo de programación dinámica cuyos detalles no comentaré aquí.

En resumen, la clave del Modelo de Markov es que la probabilidad de encontrar cada estado se calcula exclusivamente en base al estado inmediatamente anterior. Aquí lo hemos ilustrado con nucleótidos, pero también puede usarse un modelo de Markov con codones en cuyo caso tendríamos sesenta y cuatro estados en lugar de cuatro y la probabilidad de encontrar un codón dependería del codón inmediatamente anterior.

Filogenética y evolución del genoma

La filogenética computacional es el área de la genómica computacional que se ocupa de estudiar la relación entre especies o taxones (grupos de organismos emparentados). Supongamos que tenemos cinco especies: A,B,D,E y F. El primer desafío es definir qué caracteriza a una especie. Esto se hace, en principio, mediante la observación externa. Y a continuación habrá que determinar qué variaciones en el ADN causan la biodiversidad. Esta labor de caracterización de las especies no es nada sencilla, pero, por el momento, vamos a suponer que, tras una árdua labor, ya la tenemos hecha para nuestras cinco especies. Además presumiremos la existencia de algún tipo de reloj molecular que marca el ritmo de la evolución. Con estas hipótesis una posible forma (muy simplificada) de modelar la evolución es mediante árboles ultramétricos. En un árbol ultramétrico, cada nodo interno tiene exactamente dos sucesores y un número estrictamente decreciente desde la raíz.
Árbol ultramétrico
Este árbol expresa que las especies A y B surgieron a partir de la C (posiblemente extinta) hace 3 unidades de tiempo. Y la la D y la G surgieron de la H hace 5 unidades de tiempo. En la práctica, los números en los nodos internos del árbol se obtienen normalmente por alineamiento de secuencias, es decir, se asume que el grado de variación entre especies está correlacionado con el tiempo.

Para la búsqueda de un árbol filogenético que requiera el menor número de eventos evolutivos (reconstrucción filogenética) pueden emplearse diversos métodos: máxima parsimonia, máxima verosimilitud, inferencia bayesiana (IB) y matriz de distancias son los más comunes que por brevedad no describiremos aquí. El lector interesado puede encontrar más detalles sobre filogenética y modelos de Markov en el texto clásico Biological Sequence Analysis.

Búsquedas en bases de datos de secuencias

Debido a que el alineamiento de secuencias es computacionalmente costoso (proporcional al producto de la longitud de las secuencias), se necesita alguna técnica heurística para buscar una secuencia recientemente obtenida en una base de datos de secuencias conocidas. Especialmente si existe un elevado número de usuarios buscando concurrentemente alineamientos en una base de datos.

La primera herramienta que se popularizó para buscar secuencias relacionadas fue BLAST (Basic Local Alignment Search Tool). La idea de la primera versión de BLAST fué que si dos secuenciias son similares –en el sentido en el que hemos definido la similutud por la existencia de un alineamiento con una buena puntuación en la métrica anterior– entonces existirán subcadenas de nucleótidos idénticas entre las dos secuencias. Por ejemplo:

AACTACTATAAGAA
AACTCCAATAGGAA

La hipótesis de BLAST es que si en dos secuencias no es posible encontrar una cierta cantidad de subcadenas idénticas de suficiente longitud, entonces es poco probable que exista ningún buen alineamiento entre las secuencias. BLAST sólo proporciona resultados probabilísticos porque es fácil construir ejemplos de secuencias que no cumplen la condición de BLAST y que en cambio se pueden alinear bien insertando espacios y usando matrices de substitución. Por “suficiente longuitud” de las subcadenas idénticas se entiende aquella que hace poco probable que la coincidencia sea casual. Como hay 4 bases A,T,C,G entonces la probabilidad de que dos nucleótidos cualesquiera sean iguales por casualidad es del 25%. Por eso, para el ADN, se suelen tomar subcadenas de longuitud a partir de 11. O al menos así era en las primeras versiones de BLAST, porque comparando los candidatos que devolvía BLAST con los mejores alineamientos locales hallados mediante Smith-Waterman se comprobó que una opción mejor era acortar las subcadenas con la condición adicional del que se pudieran encontrar muchas de ellas próximas las unas a las otras. No voy a detallar aquí las razones estadísticas por las cuales BLAST selecciona secuencias candidatas a ser similares a una secuencia dada, dejémoslo en que para la secuencia buscada BLAST proporciona una lista de resultados ordenados por puntuación P y, además de P, BLAST proporciona otro valor llamado E que indica la probabilidad de encontrar la misma o mayor cantidad de resultados con puntuación P para la secuencia buscada si la base de datos estuviese compuesta de secuencias puramente aleatorias.

Bases de datos de ADN y proteinas

Cuando se secuencia una nueva cadena de ADN, se compara mediante alineamiento con otras secuencias conocidas y se añaden anotaciones que señalan la localización de los genes y el resto de regiones que controlan lo que hacen los genes: dónde empiezan y terminan intrones y exones, secuencias reguladoras, repeticiones, función biológica, expresión etc. Existen herramientas para anotar automáticamente que suelen usarse en combinación con anotaciones realizadas manualmente.

Ensembl.org

El resultado de la secuenciación, alineamiento y anotación se almacena en una base de datos. Existen bastantes bases de datos públicas y privadas. Sólo en Wikipedia puede encontrarse una lista con 180 bases de datos de ADN y proteínas. La más popular es la International Nucleotide Sequence Database (INSD) que agrupa la japonesa DNA Data Bank of Japan, la norteamericana GenBank y la europea EMBL-EBI. Existen también bases de datos específicas de genes que causan enfermedades y bases de datos de expresión genética.

Software disponible

Hitóricamente, el lenguaje de referencia para aplicaciones de bioinformática era Perl, aunque con el paso de los años han ido apareciendo herramientas en otros lenguajes como Java, R y Python. EMBOSS, posiblemente la herramienta más popular para realizar alineamiento de secuencias está escrito principalmente en C. Incluso hay una distro de Ubuntu llamada Bio-Linux que contiene más de 250 programas libres para bioinformática.

Lo típico es usar una base de datos de secuencias basada en BLAST como la del EMBL-EBI, un analizador-ensambldor como EMBOSS o Staden, un programa de predicción de estructura protéica como THREADER o un programa de modelado molecular estilo RasMol.

Incluso Google ofrece su plataforma cloud con fines específicos de genómica computacional.

En general, la caja de herramientas del bioinformático contendrá más o menos lo siguiente:

• Análisis de secuencias, mutaciones, regiones, etc.
• Cálculo de similitud y homología de secuencias, ancestros, etc.
• Análisis estructural 2D/3D de proteínas.
• Análisis de función de proteínas (a partir de su estructura).

En Wikipedia se puede encontrar una lista de software Open Source para bioinformática. También existen listados de proveedores de software y servicios de genómica computacional y listados de las principales empesas de bioinformática.

Hardware de propósito específico

El tratamiento informatizado de la información genética es un desafío complejo que tiende a alcanzar los límites del hardware actual, tanto en uso de CPU como en consumo de memoria y capacidad de almacenamiento. Prácticamente desde que se inventaron las FPGA (Field Programmable Gate Array) hace treinta años, se sabe que pueden usarse en lugar de CPUs para acelerar la ejecución de algoritmos de alineamiento de secuencias. La clave es que el algoritmo de Smith-Waterman se puede paralelizar parcialmente y, además, sólo requiere aritmética de 24 bits. Entender cómo se consigue acelerar la ejecución mediante el paralelismo requeriría entrar en los detalles del algoritmo, cosa que no hemos hecho, por consiguiente el lector interesado puede referirse a artículos como éste.

La empresaa pionera en hardware específico para el alineamiento de secuencias es Timelogic, fundada en 1981 y adquirida en 2003 por Active Motif. Luego se sumaron otras como SGI y, porsupuesto, los fabricantes de hardware de toda la vida con las mismas máquinas pero con una etiqueta nueva que pone “cluster de bioinformática”.

Retos actuales

Es dificil enumerar los retos en un área como la genómica computacional donde todavía está prácticamente todo por hacer. Actualmente es posible secuenciar ADN de forma económicamente viable pero en el ensamblado de las lecturas cortas producidas por los secuenciadores como Illumina todavía existen problemas abiertos relacionados con las repeticiones y la fase.

Analizar el amplísimo rango de fenotipos con la limitada base de la información disponible sobre el genoma humano es otro desafío.

El entendimiento de cómo funcionan las secciones reguladoras es aún escasísimo.

Y existen innumerables problemas técnicos que no tienen que ver con el tratamiento informatizado sino con el hecho de que el ADN funciona a nivel molecular y, por consiguiente, es demasiado pequeño cómo para poderlo manipular directamente.

Todo ello no menoscaba el potencial de la bioinformática, pues simplemente estamos en los albores de un salto cuántico hacia adelante en nuestro entendimiento sobre cómo funciona la vida.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Genómica, Tecnologías Emergentes | Deja un comentario

El Quejido Nacional

QuejaFué en una inspiradora charla de José María Gasalla organizada por un ex-presidente de EO-Madrid donde escuché la expresión del “quejido nacional” para referirse a esa gente (o así lo interpreté yo) que es demasiado perezosa como para ser feliz.

Gracias a mi profesión, he tenido la suerte de conocer a muchas personas capaces y exitosas. Les he visto protagonizar eventos estelares y también pasar las de Caín. Les he visto llorar de desesperación, les he visto hacer cosas que no puedo poner por escrito, pero nunca, ni una sola vez, a ninguno de ellos, le oí lamentarse de su (mala) suerte o de la dureza de su entorno.

Este es un artículo de opinión. Normalmente evito opinar en público, porque las opiniones son como los culos: todo el mundo tiene uno. Haré una excepción puntual con el quejido, por si alguien se aburre con el café y no le apetece uno de mis artículos técnicamente espesos.

El origen del quejido

El origen del quejido es gente que crece dando por sentado que el estado de bienestar beneficencia que les rodea es el orden natural y espontáneo de las cosas. Es gente que piensa que no hay basura en las calles porque nadie la tira o que el césped de los parques está despejado en invierno porque las hojas otoñales se evaporan. Mariano Rajoy, dos veces presidente de España, dijo una vez en un mítin que “esto no es como el agua que cae del cielo sin que se sepa exactamente por qué”. En los países desarrollados hay tantas cosas que caen del cielo que la gente ya no sabe ni de dónde vienen.

Entonces se producen dos fenómenos: primero, la privación –aunque sea momentánea– de los privilegios artificiales provoca una indignación inmediata; y segundo –aún peor– se piensa que aquellos que carecen de los privilegios debe ser porque algo muy malo habrán hecho para merecer semejante infortunio.

Atajos mentales

Hace ya algunos años, pedí la baja voluntaria de un buen empleo para dedicarme a otras aspiraciones vitales. Se trataba de un buen puesto, de esos con buena paga, una mesa frente a la ventana y una plaza de aparcamiento reservada. Antes de irme le sugerí a la persona más próxima a mi en competencias que quizá debiera postularse para el cargo. “No me lo han ofrecido” me espetó con seridad. Casi me parto de la risa en ese mismo momento “¿Ofrecérselo?” (pensé). Sencillamente era más fácil quejarse de lo que no estaba haciendo su jefe que currarse el ascenso ¿verdad?

Por bien fundamentadas razones, el cerebro siempre intenta hacerlo todo con el mínimo esfuerzo. O debería intentarlo porque también hay gente empeñada en hacerlo siempre todo del modo más difícil. Pero las razones para hacerlo todo de la forma más difícil serían otra larga historia. En la mayoria de los casos prevalece la pereza. Entonces es más fácil pedir (exigir) que hacer.

La imputación de responsabilidad, o abuso, a un tercero puede proporcionarnos un alivo temporal a una situación de stress, pero constituye una práctica muy peligrosa debido a que por efectos neuroplásticos las sinapsis que se activan juntas tienden a unirse. Entonces la queja crea un hábito y ya no sabemos hacer ninguna otra cosa que quejarnos. Peor aún, la repetición del mantra quejica crea un sesgo de confirmación por el cual acabamos creyendo ciegamente en nuestras opiniones negativas a medida que nos obsesionamos más y más con ellas hasta que acabamos pensando que el Universo conspira contra nosotros, esta Teoría del Universo Contra Ti la explica de una forma muy divertida Emilio Duró.

La quejumbrera crónica tampoco es nada buena para hacer amigos, ya que es poco probable que las mismas personas a quienes se critica estén muy predispuestas a ayudar. La queja nos desposee de empatía al negarnos a especular sobre por qué algunas personas nos defraudaron. La queja indignada nos impide perdonar y entender, y a la postre el quejica acaba rodeado sólo de personas que son realmente tan deplorables como él piensa, porque la gente mentalmente saludable se harta de tanta negatividad y se aleja.

La queja sistemática nos ancla en el pasado y en las razones por las que no podemos hacer algo. Nadie triunfa mirando atrás y exigiéndole a los demás que hagan (o dejen de hacer) algo.

En definitiva, la queja es lo peor, tan mala que hay hasta gente que escribe artículos en blogs quejándose de los que se quejan.

Post relacionado: Cómo evitar arruinarlo todo con violencia verbal.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Mitos, arquetipos y filosofía, Off-topic | Deja un comentario

Cosas a tener en cuenta a la hora de incorporar a un socio director

Por gusto o necesidad, un cambio que prácticamente todos los emprendedores de éxito tienen que abordar en algún momento es la incorporación de un socio director. Puede que sea por el deseo de tener una ocupación vital diferente de ejercer un determinado cargo ejecutivo, porque lo impongan los inversores o porque la jubilación forzosa haga perentorio un plan de sucesión.
Reemplazar a un socio fundador en el puesto de director general no es fácil, la historia de las empresas está plagada de errores garrafales en la elección de un capitán general. Hace algunas semanas hablaba con un viejo amigo emprendedor en la situación de buscar a alguien que ocupe su cargo, lo que sigue es la transcripción de la conversación sobre nuestras ideas y peripecias reclutando a un sucesor.

Esencialmente el desafío tiene tres partes: 1ª) cómo encontrar al candidato adecuado, 2ª) qué funciones otorgarle, 3ª) cómo motivarle y retribuirle.

Fuentes de candidatos

El proceso de encontrar y contratar a un director general es largo. Normalmente no debería asignarse un plazo inferior a un año para la misión. Existen básicamente tres posibilidades: 1ª) promocionar alguien de la plantilla, 2ª) contratar a alguien de la plantilla de otra empresa y 3ª) apostar por un candidato experimentado pero independiente.

De estas tres opciones, la tercera es la que yo personalmente elegiría en el caso de ser posible. La razón principal es que las habilidades necesarias para medrar entre los directores de división y los miembros del consejo son, en general, diferentes de las necesarias para liderar una empresa. Los directores de división ascienden generando eficiencias en los procesos. Los miembros del consejo se mantienen en el cargo porque representan los intereses de algunos accionistas. Los ejecutivos y consejeros no necesitan ser líderes visionarios ni carismáticos para trepar. Es posible que bajo el mando de un ejecutivo de larga carrera en la casa la empresa aumente espectacularmente su beneficio, porque es gente que conoce detalles operativos del negocio que el fundador no tuvo tiempo de analizar o nunca quiso tener en cuenta. Pero rara vez estos ejecutivos asalariados consiguen crear en la empresa una dinámica de conquista de nuevos mercados y oportunidades. En algunas ocasiones el jaleo interno que existe en la empresa justo antes de que dimita el fundador-director es tan grande que sólo alguien que conozca bien los entresijos y cuente con apoyos puede conseguir poner un poco de orden.

No menos prudente hay que ser con los “paracaidistas”. Especialmente con aquellos que alardean de sus excelentes contactos en el sector (que casi nunca son tan buenos) y con los que no tienen ningún pudor en mentir de forma descarada en su currículum apuntándose sin rubor méritos que jamás obtuvieron y competencias que no tienen.

En el caso de ser posible, mi candidato favorito sería un “entrepreneur in residence”, un emprendedor que dejó de serlo porque vendió su empresa, porque quebró o porque tenía otras aspiraciones vitales.

A veces los candidatos provienen de empresas de consultoría externa y empezaron como asesores del consejo haciendo PowerPoints. Algunos de estos consultores pueden llegar a ser muy brillantes. Aunque hay que tener en cuenta que el trabajo de consultoria es diferente del ejecutivo, por eso probablemente Peter Drucker jamás dirigió una empresa.

Por último, es posible recurrir a un head hunter, a lo cual yo personalmente sólo recurriría en el caso de que no pudiese escoger ninguna de las opciones anteriores. Las razones son que un director general requiere una confianza que es imposible de crear en sólo unas pocas semanas o meses. Nunca hay que cambiar a los viejos amigos por nuevos amigos. Esto se puede comprobar en muchísimos ejemplos de organizaciones donde se eligió al candidato de más antiguedad aunque menos competente en lugar de al candidato más competente pero con menos lazos históricos. Los políticos llevan esto al extremo reclutando en ocasiones a sus compañeros del colegio para cargos de alto funcionario. La otra razón para no delegar el proceso en un head hunter es que el head hunter (diga lo que diga) tiene su propia agenda y sus propios intereses, que son básicamente colocar al candidato más rentable (para él) en el menor tiempo posible.

Esquema retributivo

Cuando se negocia la retribución con alguien que no es emprendedor vocacional, prácticamente todos los candidatos quieren lo mismo: un gran salario y participaciones en la empresa, además de lo cual a veces piden otras cosas adicionales como coche de empresa, un despacho de no menos de X metros cuadrados, volar en business, etc.

A mi personalmente me parece injusto que una persona tenga todas las ventajas de un asalariado y todas las ventajas de un emprendedor, sin ninguna de las desventajas de ambos. La solución de compromiso suele se casi siempre un plan de opciones sobre acciones (stock options). El candidato vendrá y pedirá, de saque, tener al menos el 20% de la empresa. Esto nunca hay que otorgárselo por las buenas pues en caso de hacerlo ¿por qué habría el nuevo socio de trabajar nunca más en la compañía? A partir del primer día podría simplemente sentarse a esperar que su 20% de participación le reporte beneficios mientras él juega al golf y otros trabajan.

Lo habitual suele ser un plan de opciones sobre acciones a cinco años. Si el objetivo es que el socio director acabe con un 20% de la empresa, entonces se le otorgará un derecho de compra del 4% anual mas o menos con la siguientes condiciones:

1ª) Se hará una valoración de la empresa en el momento de la incorporación del socio de la cual saldrá un precio por acción. El nuevo socio adquirirá un derecho anual de compra de acciones con un precio relacionado con el que tuvieran las acciones en el momento de la incorporación del socio a la empresa.

2ª) Cada doce meses el socio podrá comprar el porcentaje anual de acciones por el precio pactado. Desde la fecha de entrada en vigor del derecho hasta su ejecución, el socio tendrá un plazo de seis meses para desembolsar el precio de las acciones. En caso de no comprar las acciones durante esos seis meses perderá el derecho de adquirirlas.

3ª) El socio tendrá un periodo de “lock-up” mínimo de un año desde la adquisición de cada lote durante el cual no podrá venderle a nadie las acciones recién adquiridas (excepto a la propia empresa de mutuo acuerdo).

4ª) Transcurrido el lock-up, el socio podrá vender sus acciones libremente pero estará obligado a vendérselas a los otros socios o a la empresa en el caso de que estos presenten una oferta igual a la de un tercero.

5ª) Si el socio causa baja voluntaria en la empresa entonces perderá todos los derechos de adquisición de más acciones.

6ª) Si el socio es despedido podrá conservar los derechos de adquisición del siguiente lote anual de acciones.

7ª) (Opcional) Los socios fundadores tendrán derecho de arrastre, en el caso de que decidan vender la empresa a un tercero, el socio director contratado podrá ser obligado a vender también sus acciones a ese tercero. Esta cláusula se suele acompañar de otra que establece que la venta nunca podrá forzarse por menos de cierta cantidad por acción o que, si se fuerza, el vendedor recibirá una compensación adicional por otra vía (ratchet).

8ª) El adquiriente se compromete a no usar las acciones como garantía real de ninguna operación crediticia personal. Esta cláusula es cuestionable desde el punto de via jurídico además de ser difícil de ejecutar en la práctica, pero yo la he visto por escrito en contratos.

9ª) El cónyuge, caso de existir, renunciará a los derechos sobre las acciones en caso de divorcio. Esta es otra cláusula cuestionable. Su razón de ser es impedir que de la noche a la mañana se presente un esposo/a divorciada en el consejo de administración. Pero existe un principio de derecho que establece que uno no puede renunciar a aquello que no conoce. Por consiguiente, aunque el cónyuge hubiera renunciado a sus derechos sobre las acciones podría alegar que en el momento de la renuncia desconocía el valor que las mismas podían llegar a tener y que en el caso de haberlo sabido no habría renunciado.

10ª) Si la empresa realiza una ampliación de capital entonces todos los socios podrán entrar en ella de forma que mantengan su porcentaje de participación, pero deberán pagar las nuevas acciones al precio actual y no al precio que tengan garantizado para sus opciones. En el caso de que no acudan a la ampliación de capital sufrirán una dilución de su participación. En ningún caso los socios podrán vetar una ampliación de capital.

11ª) Los dividendos se repartirán según decida el consejo de administración. Normalmente de forma proporcional a la participación de cada socio, aunque es ocasiones es posible aprobar una retribución adicional para socios que trabajan versus socios que sólo participan financieramente.

12ª) Cuanto más detallado sea el plan de salida y más opciones contemple, mejor. Una de las cosas que suele omitir el pacto de socios es, precisamente, cómo se cambiará el pacto de socios. Muchas empresas se crean para venderlas, otras pueden ser adquiridas por sus directivos o por un inversor externo en una compra apalancada. Unas pocas salen a bolsa. Sea cual sea el desenlace, si está previsto de antemano mejor que mejor.

Por último, en España, es menester tener en cuenta el umbral mínimo del 5% de participación para tener algún poder real en un consejo de administración. Es decir, cualquiera que aspire a poder pedir cuentas a sus socios nunca debe quedarse por debajo del 5% de participación.

Psicología de la relación con el socio

Todos los socios buscan en último término algo. Algunos están orientados al logro. Otros quieren comprarse una casa más grande para que su mujer acceda a intentar tener un tercer bebé que esta vez sea varón. Otros quieren impresionar a sus viejos amigos del colegio con un gran despacho. O demostrarle al mundo que las faldas pueden más que los pantalones. O mudarse a Bali y vivir de rentas. Cada socio quiere algo. Entender esta motivación es crucial para evitar disfuncionalidades en la dirección de la empresa. Para esto es necesario conocer no sólo al socio sino a todo su sistema familiar y social.

Artículos relacionados:
El método de Joel para repartir la propiedad de una start up.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Emprendizaje | Deja un comentario

Cómo seleccionar una plataforma de desarrollo para un proyecto web II

Este artículo es una actualización de otro anterior publicado en 2013 sobre Java/Tomcat, PHP/Zend, Python/Django y C#/IIS.

Desde 2013 dos plataformas, Play y Node.js, han aumentado con fuerza su popularidad entre los desarrolladores debido a las siguientes tendencias en el diseño de aplicaciones web.

1ª) Crecimiento de la base de usuarios de los lenguajes base. JavaScript en el caso de Node.js y Scala en el caso de Play. Sumado a una tendencia generalizada hacia un estilo de programación más funcional.

2ª) Obsesión por las llamadas no bloqueantes. El “problema” de diseño de la mayoría de los servidores web es que usan un hilo de ejecución (thread) por conexión. Esto en la práctica limita el número de conexiones concurrentes por máquina a algo entre 200 y 400 antes de que la sobrecarga debida al cambio de contexto entre hilos empiece a perjudicar el rendimiento del servidor. El maximizar la cantidad de conexiones concurrentes sin degradar el rendimiento siempre ha sido un desafío técnico en los sitios web pero la necesidad se ha vuelto mucho más acuciante desde que se pusieron de moda las páginas web que cargan contenidos dinámicamente de forma constante mediante llamadas AJAX o requieren de actualizaciones frecuentes de datos desde el servidor. En Java, desde la especificación de servlets versión 3.0 (creo) es posible crear servlets asíncronos pero es bastante complicado. Además, JDBC es un API síncrono lo cual dificulta el desarrollo de servlets asíncronos.

3ª) Renderizado en el cliente. Otra moda encabezada por toolkits como Angular JS y React JS es pedir datos en formato JSON al servidor y renderizar la página en el cliente mediante JavaScript en lugar de pedir una página ya renderizada. Si bien se puede argüir que trasladar el trabajo de renderización al cliente reduce la carga en el servidor, yo personalmente estoy en contra de hacer sitios web que sólo muestren algo decente si JavaScript está activado en el navegador. Para renderizar en el cliente la verdad es que no entiendo muy bien por qué los fabricantes de navegadores nunca soportaron XSLT decentemente. Supongo que XSLT es simplemente demasiado complejo para el programador promedio y por eso nunca dejó de ser una tecnología de nicho.

4ª) Escalabilidad horizontal. Es decir, la capacidad para poner con facilidad un servidor web al lado operando en paralelo. La mayor dificultad para esto es cómo traspasar el estado de un servidor a otro en el caso de que el balanceador de carga mande a la misma sesión del cliente de un servidor a otro. La solución, tanto de Node.js como de Play, es simplemente crear servidores sin estado. O dicho de otra forma, trasladar el problema de mantener el estado del cliente a otra parte que no sea el servidor web. Lo cual es una solución o simplemente mover el problema de un lado a otro según sea la implementación. Aunque tanto Node.js como Play traen servidores web propios, ambos están diseñados (desde mi punto de vista) para ser utilizados con un proxy inverso (normalmente Nginx).

5ª) APIs REST y microservicios.

Node.js

Node.js es una plataforma basada en el ejecutor de JavaScript Chrome V8 de Google. Creada en 2009, su popularidad se ha disparado en los últimos tres años. Antes de escribir sobre Node.js he de avisar que yo no tengo una opinión imparcial. Creo que no se debería usar JavaScript en el lado del servidor y Node.js me retrotrae psicológicamente a la era de Netscape Enterprise Server veinte años atrás. Dicho lo cual, pasemos a comentar las ventajas de Node.js. La primera de ellas es que es muy fácil empezar a usar Node.js. Un factor crítico para la adopción rápida de una plataforma es que el tiempo requerido para llegar al “Hola Mundo!” no supere los veinte minutos y en esto Noode.js cumple con creces. Si sabes JavaScript y quieres conseguir resultados rápidos, entonces Node.js es tu plataforma. Además, presuntamente Node.js soluciona el Problema C10K mediante entrada/salida no bloqueante y el compilador Just In Time (JIT) de Google que ejecuta JavaScript más rápido que nadie o, al menos, más rápido que Rhino y tan rápido como el HHVM de PHP. El repositorio de paquetes npm (estándar para Node.js) es apabullante (unos 88.000). Y Node.js eclipsa a cualquier otra plataforma en el desarrollo de microservicios sobre HTTP.

Node.js bucle mono hiloHasta aquí las buenass noticias. Ahora las malas. Para empezar, el bucle principal de Node.js es un único hilo de ejecución que lanza hilos de un pool. En la práctica esto implica que: a) es facilísimo bloquear un servidor Node.js con una única llamada a algo que deje el bucle principal tostado y b) como corolario de lo anterior, si tienes una máquina con cuatro CPUs probablemente estarás mejor con cuatro servidores de Node.js arrancados en ella.

El modelo de concurrencia de Node.js está basado en callbacks. Esto consiste en que cada vez que se hace una llamada asíncrona se se proporciona una función a la cual la subrutina debe llamar cuando termine. La razón de esto es usar un lenguaje inherentemente síncrono (JavaScript) para tareas asíncronas. Lo cual provoca un fenómeno conocido como callback hell.

La siguiente trampa llega a la hora del mantenimiento. Yo creo que nunca se debería usar un lenguaje con tipado dinámico para un proyecto que involucre a más de cinco desarrolladores quienes, además, sean absolutamente fanáticos de TDD. Esto incluye JavaScript y Python. El motivo es que cada vez que cambias el interfaz de una clase o los parámetros de una función en una librería escrita en un lenguaje de tipado dinámico no existe una forma fácil y fiable de saber a cuántas subrutinas cliente de la librería estás afectando y cómo.

Por último, existe un serio problema de seguridad permamente con JavaScript en el lado del servidor.

Mi conclusión es que Node.js es adecuado cuando el objetivo es crear rápidamente un proyecto que nunca crecerá por encima de un determinado umbral de trafico y desarrolladores pero no recomendaría su elección para proyectos con altos requerimientos de crecimiento en líneas de código.

> Play

Play, desde mi punto de vista, es la versión Java de Django. Opino que es la mejor plataforma para proyectos ambiciosos que no deseen pagar la bajada de bandera de Java/Tomcat/Spring. Al igual que con Node.js, empezaré enumerando las ventajas y luego las desventajas. Lo primero que se agradece en Play es que se trata de un intento de entregar un entorno MVC verdaderamente “full-stack” desde el HTML, CSS y JavaScript o CoffeeScript del lado cliente hasta los controladores y el modelo del lado servidor escritos en Java o Scala. Aunque Scala está todavía muy por detrás de JavaScript en cuanto a comunidad de usuarios, mi opinión es que Scala es claramente superior a JavaScript como lenguaje para el desarrollo de aplicaciones de alta escalabilidad/fiabilidad.

Como ya he comentado, el diseño conceptual de Play se parece al de Django: el asistente de creación de proyecto proporciona una estructura predefinida de aproximadamente unos 35 archivos (mucho más compleja que la estructura por defecto de Node.js). La idea es que el desarrollador tenga una manera por defecto defecto de hacer todo: plantillas HTML, persistencia en SGBDR, etc. Pero que pueda cambiar este comportamiento según le convenga.

El modelo de programación asíncrona de Play también es mejor que el de Node.js Al estar basado en Java, Play está supeditado a que el API de JDBC que es síncrono, pero por encima de él es posible utilizar Akka o ReactiveX. Además de que está disponible el API NIO de Java para acceso a archivos.

Play proporciona recompilado en caliente de páginas y clases como Django y Node.js. Algo muy fastidioso en Tomcat es que en un momento dado sus creadores decidieron que la forma correcta de desplegar aplicaciones debía ser mediante un WAR que no es ni más ni menos que un archivo ZIP que contiene toda la aplicación. Los WARs son justo lo contrario de los cambios incrementales deseables en un sistema con integración contínua y, además, requieren de re-arrancar el servidor para que se apliquen los cambios. Y este tiempo de re-arranque de todo el servidor es verdaderamente mortal para los cambios continuos durante el desarrollo. Existen soluciones a este problema como JRebel o DCEVM pero JRebel es de pago y DCEVM es Open Source pero bastante difícil de configurar.

Para la instalación de paquetes Play usa SBT y la cantidad de paquetes disponibles por defecto es algo así como 80. Pero Play puede hacer uso del repositorio de Maven donde hay más de 80.000 paquetes adicionales.

Ahora las malas noticias. Definitivamente no es buena idea intentar usar Play para obtener resultados rápidos a menos que se tenga una buena idea previa de Scala, y Scala no es fácil de aprender. Otro aspecto negativo es que históricamente las versiones de Play han tenido tendencia a romper la compatibilidad hacia atrás. Aunque gracias al tipado estático el problema es mucho más manejable con con Node.js cuando cambia una librería JavaScript. El compilador de Scala tiene fama de ser lento pero Play soporta compilación incremental además es probable que la velocidad se mejore en el futuro cuando se popularice Dotty como el nuevo compilador de Scala.

Mi impresión general es que Play constituye un paso adelande de Apache/PHP, Tomcat/Java e IIS/C# como la opción más moderna para aplicaciones web de tamaño mediano y grande.

Post relacionado:
Cómo seleccionar una plataforma de desarrollo para un proyecto web.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Tecnologías Emergentes, Tecnologías Libres | Deja un comentario

Mentalidad medieval

Ejecutivo medieval hipsterRecientemente encontré compartido en Facebook un artículo de The Economist titulado The alphabet of success sobre las guerras por el talento. Para ilustrarlo los editores han seleccionado una fotografía alegórica de un mando intermedio mitad ejecutivo hipster mitad caballero medieval. No sé si la imagen simboliza algún tipo de admiración idealizada por los guerreros de antaño o si la han colocado con doble intención (lo más probable). Pero en cualquier caso me ha servido para recordar que organizativamente seguimos en la edad media.

Según la moda actual, la misión de un director general (y de su director de recursos humanos) es crear una “misión, visión, valores” e inspirar a las personas con más talento para que se unan con fervor a la causa. Esto no difiere mucho de la misión del Rey Arturo y sus Caballeros de la Mesa Redonda buscando el Santo Grial. Por desgracia, la vida de los caballeros medievales solía ser muy dura y su esperanza de vida bastante corta. A pesar de lo cual, parece ser que llegar a caballero y morir en batalla descuartizando a uno de tus pares se consideraba un gran honor.

Si bien admiro y respeto las grandes causas, a mi me van a perdonar los monarcas pero hace ya más de tres lustros que despedí mi jefe y me hice rōnin. Ahora ya no tengo tanta estrategia como tenía de joven, coger cada oportunidad al vuelo es mi estrategia. Y me parece que no estoy solo en el empeño, pues en Europa de un tiempo a esta parte se está produciendo una verdadera epidemia de contratistas independientes que no quieren una nómina en ninguna banda salarial por ridículamente alta que esta sea. Por no hablar de EE.UU. donde la epidemia no es de contratistas sino directamente de emprendedores, y no es para nada algo nuevo.

Las aspiraciones salariales son tan elevadas que la única forma de retribuir a los empleados estrella es con opciones sobre acciones. Sin embargo, las opciones sobre acciones son un arma de doble filo. Los inversores son personas bastante avariciosas, en general, no les gusta que nadie se “forre” a su costa, ni siquiera los propios empleados que han creado la riqueza. Entonces los planes de opciones suelen estar cuidadosamente diseñados para que los plazos de adquisición de derechos sean anuales (normalmente durante un quinquenio) y, además, suele haber períodos de bloqueo en los que los empleados no pueden vender sus acciones tras haberlas adquirido. Esto en no pocas ocasiones se traduce en un medio de financiarse con los empleados, no sólo en forma de retribución diferida sino incluso obteniendo dinero líquido con las acciones adicionales que compran fuera del paquete de opciones. Eso suponiendo que las acciones suban, por supuesto, porque ya se ha visto, por ejemplo, el problemón que ha tenido LinkedIn con la caída de valor de las acciones en manos de empleados. En el siglo XX hubo empresas que forjaron millonarios. De Microsoft salieron bastantes. Y sin llegar tan lejos yo conozco empleados de Oracle que obtuvieron buenos beneficios de sus acciones en los noventa. Pero, como he comentado, los inversores han ido aprendiendo, de modo que cada vez es más difícil hacerse rico con acciones a menos que se tengan verdaderas acciones de cofundador.

Según cuenta el artículo, el director de recursos humanos de Google cree que un ingeniero “galáctico” vale 300 veces lo que un ingeniero medio. Lo cual se puede interpretar como que todas las empresas están obsesionadas por contratar al 0,3% de los candidatos. Lo paradójico de la retribución es que al 0,3% de esos empleados más buscados no les importa realmente el dinero. Creo que Vinton Cerf no sale en Forbes ni Tim Berners-Lee tampoco. Los ingenieros sobresalientes lo son porque se encuentran intensamente motivados por su trabajo, sin esfuerzo no se consigue nada, independientemente del nivel de inteligencia que se tenga. Por consiguiente, no se requieren arengas de ningún cantamañanas para mantener la llama creativa de un genio.

Alguien en recursos humanos y en la torre de marfil del consejo de dirección debería darse cuenta de que en algún momento las personas dejan atrás su ingenuidad juvenil y empiezan a preocuparse menos por ganar una fortuna y por quemar su vida intentando cambiar el mundo y en cambio se preocupan más por arreglar su propia vida, su familia, su casa, y su barrio. Muchos caballeros medievales se acaban dando cuenta de que la victoria con la cual destruyes lo que más querrías proteger no sirve para nada. También hay puestos de trabajo menos ambiciosos para sufridos pagadores de hipoteca, por supuesto, pero en ellos la gente que yo conozco a veces no es feliz y vive planeando las siguientes vacaciones, ansiando la prejubilación o simplemente pensando en acabar de pagar la hipoteca para poder cambiar de vida. Estos empleados son, precisamente, los más vulnerables a la credulidad de que el valor de sus acciones se multiplicará por cien, permitiéndoles así comprar su libertad.

Por otra parte ¿se debe crear una política de recursos humanos basada en el 0,3% de la plantilla? Al final del día se busca al empleado perfecto, que es brillante pero dócil, fiel y emocionalmente estable. Lo que sucede es que no se puede buscar un genio para cubrir un puesto. La única forma de encajar a un genio en una empresa es crearle un puesto a medida. Pero no es posible crear un puesto a la medida de todos y cada uno de los empleados. Los ingenieros veteranos (los que no son del 0,3% quiero decir) se mofan de los procesos de selección durante la hora del café. Luego los responsables de selección se quejan de que encontrar un buen candidato es como buscar una aguja en un pajar. Pero es que en el siglo XXI no se puede pretender que por darle una espada a alguien y nombrarle caballero a cambio firme un contrato vitalicio de vasallaje.

Post relacionado: El perfil del empleado perfecto.

Artículo relacionado: Trabajar en Google no es perfecto (Ainhoa Iriberri).

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Tecnología y Empleo | Deja un comentario

Computación cuántica para torpes

Dilbert on quantum computing

La computación cuántica es el tema esotérico de moda en informática teórica y práctica. Este post trata sobre ella desde el atrevimiento que da la ignorancia, pues actualmente nadie comprende la física cuántica en su totalidad, y mucho menos yo, pero sí es posible explorar sus fascinantes posibilidades. He estructurado el texto desde lo menos técnico a lo más técnico intentando evitar las ecuaciones hasta el final de modo que cada cual pueda leer hasta donde le interese.

Motivación y aplicaciones de la computación cuántica

El orígen de la computación cuántica se atribuye a Paul Benioff y Yuri Manin en 1980, y a un artículo de Richard Feynmann en 1981 en el cual sugirió que dado que es extraordinariamente difícil simular el comportamiento cuántico con ordenadores convencionales entonces una forma mejor de estudiar modelos de la realidad sería fabricar ordenadores cuánticos. Grosso modo la complejidad del problema estriba en que en un sistema cuántico las partículas y sus interacciones no pueden considerarse por separado como si fuesen bolas en una mesa de billar sino que hay que tratar todo el sistema en conjunto.
Los estudios sobre la viabilidad práctica de construir dispositivos computacionales que usen efectos cuánticos se remontan a hace ya más de una década, pero desde que recientemente Lockheed Martin, Google, la NASA y la CIA se interesaron por el producto de la empresa D-Wave, las publicaciones como Wired se han plagado de artículos sobre los dispositivos computacionales cuánticos presuntamente venideros. Quiero enfatizar el término dispositivo computacional versus ordenador porque hoy por hoy no existe tal cosa como un ordenador quántico, sólo existen máquinas que ejecutan determinados algoritmos concretos utilizando efectos cuánticos para acelerar la resolución de problemas especialmente difíciles de resolver con algoritmos clásicos.

La computación cuántica no revolucionará a corto plazo la informática en nuestros hogares pero podría catalizar avances científicos que influirían enormemente en nuestras vidas cotidianas. La razón de que la computación cuántica esté limitada a centros de cálculo es que lo más parecido que existe actualmente a un ordenador cuántico es una nevera gigante cuyo interior está a 20 milikelvis. Es por ello que el modelo de negocio de supercomputación cuántica se orienta más hacia SaaS que hacia la venta de hardware.

La computación cuántica no hará (por ahora) que nuestros emails se abran más rápido ni que los gráficos de los juegos mejoren. Pero podría servir, por ejemplo, para descubrir materiales superconductores a temperatura ambiente. O también podría usarse para encontrar un método de fabricación de fertilizantes mejor que el método de Haber que data de 1905 y en el que según las estimaciones se emplea actualmente entre el 3% y el 5% del gas natural y entre el 1% y el 2% de toda la energía producida por el hombre. Por consiguiente, encontrar un proceso industrial capaz de fijar el nitrógeno en amonio como hacen los diazótrofos supondría un gran ahorro de energía y emisiones de CO2. Pero las simulaciones de las reacciones químicas requeridas para fijar el nitrógeno ambiental son demasiado costosas computacionalmente para un ordenador convencional.

La mayoría de los ejemplos de aplicación se centran en problemas de optimización como encontrar el tratamiento de radioterapia óptimo para eliminar un tumor causando el mínimo daño colateral al paciente. Aunque existen dos excepciones notables: las aplicaciones en inteligencia artificial y el ataque a sistemas criptográficos. Esta última aplicación ha atraido mucha atención pues los algoritmos DSA y RSA con los que está encriptado la gran mayoría del tráfico de Internet son vulnerables a ataques por un computador cuántico lo bastante potente (que actualmente no existe). Por consiguiente, tanto gobiernos como grandes empresas están muy interesados en controlar la computación cuántica, o al menos una parte de ella, y ya existen muchas patentes sobre algoritmos y tecnologías cuánticas aplicadas a la computación.

Limitaciones cuánticas de los ordenadores digitales

Una de las predicciones futurológicas más acertadas de los últimos 50 años es la Ley de Moore. Enunciada en 1965 predijo que el número de transistores en un microprocesador se duplicaría aproximadamente cada 24 meses. Y se ha cumplido con una precisión sorprendente. Sin embargo, la predicción está peligrosamente cerca de un límite de posibilidades de producción.

Efecto Tunel Para meter más transistores en un microprocesador lo que se hace es reducir el tamaño de los transistores. Actualmente, los transistores más modernos se fabrican con tecnología de 14 nm (1nm = 1 mil millonésima de metro). Puede que se consigan alcanzar los 5nm en 2020. Pero a medida que se reduce el tamaño es más complicado disipar el calor y además se producen efectos de tunel cuántico debido al cual una parte de la corriente eléctrica puede saltar de un circuito a otro a través de un aislante. En la animación es posible observar cómo la función de onda de un electrón traspasa una barrera de potencial. Cuando la barrera es grande la probabilidad de que el electrón salte es a efectos prácticos cero, pero a medida que se reduce el tamaño los saltos por túnel cuántico deben realmente empezar a ser tenidos en cuenta. Como es imposible evitar los efectos cuánticos lo que hacen los ordenadores cuánticos es tratar de sacar partido de ellos.

¿Qué es la computación cuántica?

No es posible entender el estado del arte de la tecnología de computación cuántica sin entender previamente qué es un sistema cuántico. Para quién esté interesado en los fundamentos matemáticos de la mecánica cuántica la mejor introducción que yo he encontrado es la de Susskind y Friedman. También hay sendos capítulos sobre física cuántica en la monumental obra de Penrose El Camino a la Realidad. El curso sobre computación cuántica más completo que he podido encontrar es el de Michael Loceff. Sobre probabilidades cuánticas el texto de Greg Kuperberg. Y la tesis de tesis doctoral de Mario Mastriani también es bastante didáctica.

NANDPero empecemos pues con los fundamentos de la computación cuántica.

En un ordenador convencional la información se representa como cadenas de bits 0 o 1. En cada instante del tiempo, el estado del ordenador lo describen en su totalidad los estados de sus bits. Por ejemplo, en un sistema de dos bits, el conjunto de todos los estados tiene 4 elementos y es {00, 01, 10, 11}. El sistema cambia de un estado a otro haciendo pasar los bits por puertas lógicas. Por ejemplo, una puerta es NAND cuyas entradas y salidas son las mostradas en la tabla. NAND es una puerta lógica universal mediante la cual se pueden construir las otras puertas lógicas de dos bits AND, OR, NOR, XOR, XNOR mediante combinaciones de puertas NAND.

En un ordenador cuántico la información se almacena en qubits. La diferencia entre un bit y un qubit es que el qubit puede encontrarse en un estado intermedio entre 0 y 1 con una probabilidad respectiva para cada valor que en conjunto deben sumar el 100%. Para distinguir los estados cuánticos de los clásicos los escribiremos como |0⟩ y |1⟩ Esta notación se conoce como vectores ket, pero no nos interesa entrar ahora en lo que son matemáticamente los ket. Una forma de imaginar el qubit es como un átomo con un electrón que tiene dos niveles de energía (estados) |0⟩ y |1⟩
Modelo atómico de un qubit

En cada instante del tiempo el átomo (qubit) se encuentra en una superposición de los estados |0⟩ y |1⟩ Sin embargo, cuando se realiza una medida el estado se colapsa a un valor 0 o 1. La evolución de los estados es un proceso totalmente determinista que se puede predecir, pero la información disponible al observador son sólo las probabilidades de encontrar el qubit representando |0⟩ o representando |1⟩ en cada momento.

En la ecuación del gráfico, además, los estados están separados por una fase denotada por la letra griega phi (φ) cuyos detalles no comentaremos aquí.
Según esto, la información que almacena un sistema cuántico es mucho mayor que la que almacena un sistema digital clásico, ya que no sólo contiene cero o uno sino una descripción de la probabilidad de que cada bit se encuentre en cero o uno al realizar una medida.
En sistemas de dos o más qubits, algunos qubits podrían formar un único sistema en lo que se conoce como entrelazamiento cuántico. Si este es el caso, entonces no es posible modificar el estado de un qubit sin alterar el estado de los otros qubits entrelazados.

Para un sistema con tres qubits los estados se representarían con un vector de 8 dimensiones:

a|000⟩ + b|001⟩ + c|010⟩ + d|011⟩ + e|100⟩ + f|101⟩ + g|110⟩ + h|111⟩

donde los coeficientes ah son números complejos y la probabilidad de encontrar al sistema en cada estado es el cuadrado de la norma de cada coeficiente complejo |a|²…|h|² La norma de un número complejo z se escribe |z| y si z = x+yi entonces la norma |z| = √x²+y²

El sistema no puede evolucionar de forma arbitraria sino que la evolución debe mantener ciertas propiedades, la más importante que la suma de probabilidades |a|²+|b|²+…+|h|² debe ser siempre igual a 1.

El criterio de DiVincenzo

En el año 2000, David P. DiVincenzo publicó un trabajo breve pero muy citado titulado The Physical Implementation of Quantum Computation en el cual enumera cinco requisitos para que un ordenador pueda funcionar basándose en efectos cuánticos:

1. Capacidad para operar con un número fucientemente grande de qubits bien caracterizados.
2. Posibilidad de inicializar el estado de cada qubit con probabilidades arbitrarias de |0⟩ y |1⟩.
3. Tiempos de vida (decoherencia) de los qubits lo bastante largos.
4. Un conjunto “universal” de puertas lógicas cuánticas.
5. Posibilidad de medir el estado de cada qubit individualmente.

Desafíos técnicos que presentan los qubits

Todos los sistemas que tratan de explotar las propiedades cuánticas de los qubits se enfrentan a las dificultades enunciada por DiVincenzo.

En primer lugar es facilísimo que el estado cuántico de un conjunto de qubits se colapse a un valor determinado debido a un fenómeno conocido como decoherencia por el entorno que se produce debido a la más mínima perturbación térmica o magnética en el qubit. Actualmente, el estado del qubit sólo puede mantenerse durante unas pocas decenas de microsegundo. Además, cuantos más qubits entrelazados hay más dificil es prevenir la decoherencia. Algunos teóricos piensan que la decoherencia de un sistema cuántico se produce de forma inevitable por efecto de la gravedad. Si eso es cierto, siempre existirá un límite de tiempo no muy largo en el que se pueda mantener el estado de un qubit ya que no es posible aislar un sistema de la gravedad.

En segundo lugar no es posible leer el estado de un sistema cuántico sin dejar el sistema en un estado desconocido. Es decir, se puede saber en qué estado se encontraba el sistema antes de la lectura pero no se puede saber en qué estado habrá quedado después de ella. Esto implica que no se pueden fabricar puertas lógicas cuánticas igual que las convencionales porque, entre otras cosas no es posible clonar el estado de un qubit.

En tercer lugar existe un serio problema de detección y corrección de errores. La corriente utilizada en los qubits implementados con superconductores es del orden de 10 microvoltios con una diferencia de energía entre el estado |0⟩ o |1⟩ de 10-24 julios. Esto es diez mil veces menor que el nivel de energia que separa un 0 de un 1 en un ordernador digital. Por consiguiente, en un ordenador cuántico es mucho más difícil distinguir un |0⟩ de un |1⟩ Pero es que para empeorar la situación aún más recordemos que los qubits sólo están en cada estado con una cierta probabilidad. No es posible en la práctica fabricar dos circuitos superconductores que representen qubits idénticos. Ante la misma señal de reseteo, cada qubit cambia a un estado con distribución de probabilidad entre |0⟩ y |1⟩ ligeramente diferente de los otros qubits. Mediante laboriosos procesos de calibración y manteniendo los qubits lo más aislados de perturbaciones térmicas y electromagnéticas se intenta que todos los qubits se comporten igual. Pero al cabo de una sucesión de operaciones siempre quedará alguna pequeña diferencia estadística en su comportamiento. Tanto es así que en el primer D-Wave instalado para Lockheed Martin sólo están operativos 108 de sus 128 qubits.

Como colofón al problema, recordemos que no es posible leer el estado de un qubit sin destruirlo, de modo que el sistema de corrección de errores debe funcionar prediciendo y corrigiendo errores que aún no se han producido. Una posibilidad es, por ejemplo, representar cada valor 0 o 1 con tres qubits que deberían ser |000⟩ bien |111⟩ Entonces es posible averiguar si el primer bit es igual al segundo. Esto no requiere medir el estado (lo cual lo destruiría) sino sólo la diferencia entre el primer bit, el segundo y el tercero que sí es posible sin destruir el estado. Pero como la comprobación de errores también está sujeta a las leyes cuánticas es posible que se produzcan errores durante el chequeo de errores. El mecanismo de detección y corrección de errores es pues bastante complicado y absolutamente necesario.

Algunos piensan que los ordenadores cuánticos basados en puertas lógicas nunca llegarán a funcionar debido que la tasa de errores debería estar en algún lugar entre uno entre diez mil y uno entre un millón de operaciones para que la corrección de errores fuese eficaz. Por otro lado, el teorema del umbral cuántico afirma que un computador cuántico puede emular a una clásico siempre y cuando la tasa de errores se mantenga por debajo de cierto umbral. Y puede encontrarse un esbozo de cómo funciona la correción de errores en los prototipos de IBM este artículo. Por último, investigadores de Google y UCSB también han publicado resultados sobre la corrección de errores en qubits.

Tecnologías para implementar qubits

Existen tres grandes líneas de investigación financiadas por grandes empresas: la de IBM, la de Microsoft y Bell Labs y la de D-Wave y Google. También se está desarrollando una intensa investigación teórica y práctica en universidades de todo el mundo.

Las tecnologías principales que están siendo investigadas por las grandes empresas para implementar qubits son:

• iones atrapados en campos electromagnéticos
• electrodos superconductores acoplados mediante uniones de Josephson (transmon)
• qubits topológicos mediante aniones no abelianos

Existen también otras líneas prometedoras de investigación como por ejemplo:

• qubits atrapados en imperfecciones diamantinas
• codificación de qubits en fotones

La línea de investigación más audaz es la de Microsoft Station Q que está apostando por qubits topológicos basados en unas hipotéticas partículas llamadas aniones no abelianos que no son ni fermiones ni bosones y que pueden llevar unidades fraccionarias de carga. Si existen, los aniones no abelianos podrían proporcionar una forma de crear qubits extraordinariamente más resistentes a errores que los basados en iones atrapados o microcorrientes. Pero es que además de existir los aniones (lo cual por ahora no está nada claro) debería ser factible moverlos por circuitos supercondutores dispuestos en forma de trenza.

Los Bell Labs también están investigando qubits topológicos contenidos en cristales ultrapuros de arseniuro de galio.

En el caso de ser realizables, los qubits topológicos aventajarían muy probablemente al resto de aproximaciones tecnológicas al ofrecer tiempos de decoherencia en dias en lugar de microsegundos y una tasa de errores varios órdenes de magnitud inferior.

D-Wave

Las únicas máquinas de computacion cuántica comercialmente disponibles por ahora, las D-Wave, usan anillos superconductores de niobio y uniones de Josephson para implementar los qubits. El estado |0⟩ o |1⟩ lo determina la dirección dextrógira o levógira de una microcorriente en el equivalente a un anillo superconductor.

Los retículos de proceso del D-Wave están compuestos de grupos de 8 qubits parcialmente acoplados entre ellos y con los qubits de otro grupo. Inicialmente el sistema se inicializa con cada qubit en una probabilidad 50%-50% de encontrarse como 0 o 1 al realizar una medida. A continuación se puede aplicar un sesgo (bias) a cada qubit para modificar su probabilidad de encontrarse en estado 0 o 1 al medirlo.

Los acopladores permiten definir entrelazamiento entre dos qubits. El efecto del entrelazamiento es asegurar que dos bits tienen bien el mismo valor al realizar una medida bien el valor contrario. Es decir, es posible especificar que si al qubit A devuelve valor 0 al ser medido entonces el qubit B también devuelve 0. O que si el qubit A devuelve 0 entonces el qubit B siempre devuelve 1.

D-Wave coupled qubitsLos D-Wave no son computadores cuánticos universales y en particular no pueden ejecutar la parte cuántica del algoritmo de Shor. Los D-Wave no son programables como un ordenador convencional. Solo permiten especificar el valor del bias y los acoplamientos entre qubits mediante matrices en Python o C. Con estos valores se crea un “paisaje” en el que el D-Wave busca un mínimo usando el algoritmo de temple cuántico descrito más adelante. El estado evoluciona desde la incertidumbre total del valor de cada qbit hasta un 0 o 1 en cada qubit medido, que representa la solución al problema especificado (gráfico derecho).

La presunta aceleración cuántica de los D-Wave ha sido objeto de un intenso debate con posiciones desde la de Matthias Troyer y otros quienes afirman que no han encontrado evidencias de aceleración cuántica hasta tests de Google que afirman que el D-Wave es hasta 100 millones de veces más rápida que un ordenador convencional en la resolución de problemas cuidadosamente escogidos. Lo que si está claro es que nadie considera la D-Wave como una máquina que sea útil en solitario. El uso que el propio fabricante propone es usar un superordenador para preparar determinados problemas de optimización y delegar su resolución en el D-Wave.

Hay una docena de videos cortos y asequibles que explican cómo funciona el D-Wave publicados por el fabricante en su canal de Youtube.

Clase de complejidad BQP

Antes de entrar a estudiar algunos algoritmos, nos detendremos brevemente a comentar la computación cuántica desde el punto de vista de la teoría de complejidad computacional. Por ahora, parece que las aplicaciones de la computación cuántica serían abordar problemas que pertenecen a la clase de complejidad BQP (bounded error quantum polynomial time) que es el análogo cuántico de la clase BPP (bounded-error probabilistic polynomial time). Hay que recordar que todos los algoritmos cuánticos son probabilísticos, es decir, devuelven la solución correcta a un problema sólo con una cierta probabilidad, que puede ser lo bastante elevada y en todo caso mayor de un tercio en todas las ejecuciones del algoritmo. Se sabe que existen problemas BQP que probablemente no son P, es decir, que no pueden resolverse en un tiempo polinómico respecto del tamaño de los datos de entrada con un ordenador convencional pero sí con un ordenador cuántico. Algunos ejemplos son la factorización de enteros que comentaremos más adelante y encontrar el polinomio de Jones. La relación entre BQP y la clase NP (no polinómicos) es desconocida aunque se cree que los problemas NP Completos no pueden ser resueltos en tiempo polinómico por un algoritmo de clase BQP.

Algoritmos cuánticos

Hay en curso una discusión teórica y técnica acerca de si la computación cuántica debería basarse en un análogo programable de puertas lógicas digitales o en otra cosa completamente diferente. Los D-Wave, las únicas máquinas comercialmente disponibles que hoy por hoy pueden reclamar el derecho de usar efectos cuánticos en sus cómputos no usan puertas lógicas sino que implementan un algoritmo concreto conocido como temple cuántico el cual comentaremos más adelante.

No sé como explicar los algoritmos sin usar formalismos matemáticos propios de la mecánica cuántica. Por consiguiente, el lector alérgico a las ecuaciones posiblemente será mejor si deja el post aquí. Tampoco puedo explicar el archimencionado algoritmo de Shor que podría servir para romper la encriptación RSA y DSA sin explicar previamente la transformada cuántica de Fourier de la que depende.

La computación cuántica funciona aplicando una función que cambia un estado a través del tiempo. Esta función del tiempo se conoce como el Hamiltoniano (Ĥ) y lo que hace es evolucionar un estado inicial |ψ0⟩ a un estado final Û(t)|ψ0⟩ a través del operador unitario Û tal que dÛ/dt = iĤ(t)Û(t)/ħ.
Ĥ normalmente representa la energía total de un estado y es el programa a ejecutar en un computador cuántico.

Transformada cuántica de Fourier

La transformada cuántica de Fourier es el análogo de la transformada discreta de Fourier de la cual daremos una definición constructiva. Se comienza con una función continua e integrable definida dentro de un intervalo de tiempo. Normalmente con forma de crestas y valles del estilo de una señal de audio o de radio como la de la siguiente gráfica.

Primero se hace un muestreo de los valores de la función a intervalos regulares de tiempo. En la gráfica 11 muestreos por segundo. En un intervalo de 3 segundos total N=33 muestreos. Estos muestreos expresan los valores de la función en función del tiempo. Para cada instante del tiempo conocemos el valor de la función.

Funcion sinusoidal compuesta

Ahora lo que deseamos hacer es expresar la función en el dominio de la frecuencia y no del tiempo. Es decir, deseamos expresar nuestra función como la suma de funciones sinusoidales de diferentes periodos. Lo cual se puede demostrar que es posible pero no abordaremos las razones de por qué. Para expresar en el dominio de la frecuencia nuestra función calcularemos la correlación entre ella y cada una de las funciones seno y coseno con una cantidad de ciclos desde 0 hasta N (el número de muestreos) durante el intervalo de tiempo en el que se aplica la transformación.

Seno y coseno un periodo

Función Seno

Si x0, x1, … xn son los valores de cada medida entonces la transformada discreta de Fourier es una serie de N números complejos X0, … Xn definido cada uno de ellos como

Transformada discreta de Fourier

Teniendo en cuenta la fórmula de Euler según la cual
eix = cos(x) + i sen(x) y que sen(-x) = -sen(x)
cada término n-ésimo del sumatorio anterior se puede expresar también como
xn (cos(2πkn/N) – i sen(2πkn/N))
expresión en la que se aprecia explícitamente cómo se correlacionan los valores muestreados con los valores de las funciones coseno y seno.

La evaluación directa de la fórmula anterior requiere N² multiplicaciones y N(N-1) adiciones lo que computacionalmente equivale a una cota superior asintótica O(N²).

Si el tamaño de la muestra es una potencia de dos, se puede emplear un algoritmo llamado Transformada Rápida de Fourier que reduce la cota superior asintótica a O(N log N).

Hasta aquí la parte clásica de la transformada discreta de Fourier. Veamos ahora la versión cuántica. Lo primero de todo hay que tener en cuenta que la transformada cuántica de Fourier se aplica sobre todo un estado cuántico y no sobre los valores de sus medidas. En el caso cuántico la transformada toma como entrada un vector de amplitudes y produce como salida otro vector de amplitudes.

Dado el estado

Estado cuántico

Su transformada quántica de Fourier se define cómo

Quantum Discrete Fourier Transform 1

donde

Transformada cuántica de Fourier 2

No se puede acelerar la transformada discreta de Fourier clásica mediante computación cuántica. Las razones son que no es posible establecer eficientemente una distribución inicial de amplitudes de probabilidad y que las amplitudes de probabilidad no son accesibles mediante medidas. Lo que podemos hacer es una medida sobre un estado y obtener |0⟩ o |1⟩ pero no es posible determinar mediante observación cual es la probabilidad de obtener |0⟩ o de obtener |1⟩ De modo que la transformada quántica de Fourier no es útil directamente sino sólo como parte de otros algoritmos que comentaremos más adelante.

Afortunadamente, existe una forma eficiente de obtener la transformada cuántica de Fourier mediante una combinación de puertas lógicas cuánticas llamadas puerta de Hadamard y puerta controlada de desplazamiento de fase. La puerta de Hadamard realiza la transformada discreta de Fourier sobre las amplitudes de probabilidad de un qubit. Para número de amplitudes que sea una potencia de dos N = 2n, la transformada cuántica de Fourier tiene una cota superior asintótica O (2n) la cual es exponencialmente más rápida que la transformada rápida de Fourier que es O(N log N) = O (2n log 2n) = O(2n n).

Estimación del periodo de una función

Supongamos que hay N dimensiones y un estado de la forma |Φ⟩ = Σ c|l+n r⟩ donde n=0…N/r-1 y |c| = √r/N. Esto se llama un estado periódico con periodo r y elemento compensatorio l. Al aplicar la transformada cuántica de Fourier a dicho estado se evolucionará a un nuevo estado |̃Φ⟩ = Σ αm|mN/r⟩ con m=0…r-1 y |αm|=√1/r para todo m. El nuevo estado también es periódico con elemento compensatorio cero cuya medida será un múltiplo de N/r. Esto se puede aprovechar para elaborar un algoritmo cuántico que encuentre el periodo basado en que si se aplica repetidamente la transformación se obtendrán resultados cuyo único factor cómún será el periodo.

Algoritmo de Shor

Algunos algoritmos criptográficos, y en particular RSA, se basan en la dificultad para encontrar los factores primos de un número entero grande (1024 bits o más). No se conoce ningún algoritmo capaz de factorizar un entero grande con una cota asintótica que sea polinómica respecto del tamaño del entero de entrada. El mejor algoritmo conocido para enteros grandes en la criba general del cuerpo de números cuya cota asintótica es exponencial.

El algoritmo de Shor lo que hace es descomponer la factorización de enteros en tres subproblemas: 1º) determinar si un número es primo o no, 2º) encontrar el mínimo común denominador y 3º) determinar el periodo de una función. Los dos primeros subproblemas se pueden resolver en tiempo polinómico con algoritmos clásicos y es en el tercero donde la transformada cuántica de Fourier marca la diferencia de complejidad asintótica utilizada en conjunción con el algoritmo clásico de expansión continua de fracciones.

El algoritmo de Shor no sirve para romper cualquier método criptográfico, sólo sirve para atacar los métodos basados en factorización de enteros como los sistemas clave pública. Los sistemas de cifrado simétrico o basados en funciones hash se consideran seguros frente a la computación cuántica.

Algoritmo de Grover

Lo que hace el algoritmo de Grover es equivalente a encontrar el valor de la variable x tal que para una función 𝑓 se verifique que 𝑓(x) = y. El algoritmo de Grover tiene una cota asintótica O(N½) y requiere O(log N) espacio adicional durante su ejecución. Intuitivamente, es equivalente a buscar a quien pertenece un número de teléfono en un listado ordenado por nombre. Sin un índice, la única forma de buscar es comprobar uno por uno el número de cada abonado lo cual requirirá en el peor caso tantas comprobaciones como abonados haya en el listado.

El problema insalvable del algoritmo de Grover, desde mi punto de vista, es que para que funcione hay que precargar toda la base de datos en qubits. Dado lo que cuesta actualmente cada qubit, es dudoso que tengamos un número de qubits suficiente para aplicaciones prácticas y, aunque lo tuviéramos, habría que precargar la base de datos entera desde un sistema externo, lo cual equivale a leerla entera con un recorrido por fuerza bruta de complejidad O(N).

El algoritmo de Grover tampoco se considera eficaz para atacar sistemas clave simétrica invulnerables al algoritmo de Shor, debido a que para aumentar el tiempo requerido por la desencriptación basta con duplicar el tamaño de la clave.

Algoritmo de temple cuántico

Salto térmico vs Tunelado cuántico El algoritmo de temple cuántico, también llamado cristalización o en inglés quantum annealing, sirve para resolver problemas de optimización o de muestreo. El problema consiste en encontrar el mínimo de una función. La versión clásica de este algoritmo, conocida como temple simulado, lo que hace es provocar alteraciones térmicas en los estados para verificar si atraviesan una barrera de potencial. El temple cuántico puede aprovechar, además el efecto túnel para cruzar barreras de potencial. Por consiguiente, el temple cuántico proporcionará más aceleración cuando el perfil de la función esté compuesto por mínimos en valles separados por crestas altas y estrechas. Una analogía ingeniosa del temple cuántico puede visualizarse en este video.

4 States SamplingVeamos ahora cómo ejecuta este algoritmo el D-Wave sobre el retículo de grupos de 8 qubits acoplados que hemos presentado anteriormente. El muestreo de la función es discreto. Supongamos que tenemos dos qubits. Entonces podemos representar 4 estados. La energía para cada estado se introduce en el bias. Lo que hace el algoritmo es buscar el mínimo de la función definida por los valores de energía. El último modelo de D-Wave tiene 1.000 qubits y, por consiguiente, puede trabajar con 21000 estados.

El algoritmo de temple cuántico hace uso de los principios de computación cuántica adiabática. En el D-Wave se define un Hamiltoniano de Ising que se compone de dos partes: una para inicializar el estado y otra que representa el problema a resolver.

Hamiltoniano de Ising

Por el teorema adiabático, el sistema representado por el Hamiltoniano de Ising evolucionará desde el estado representado por el primer término hasta el estado de mínima energía del segundo término, que es la solución al problema.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Tecnologías Emergentes, ¿Dónde estamos? ¿Hacia dónde vamos? | Deja un comentario

¿Son los campeones realmente resilientes?

Una de las cosas que me intriga sobre la (auto)biografía de los campeones es que parece que ninguno de ellos hubiese tenido jamás ni el más mínimo atisbo de duda. Como si se hubieran levantado todos y cada uno de los días de su vida, con sol, viento, lluvia o nieve, para salir a correr en pos de su objetivo. Incluso en la biografía de Nelson Mandela –quien estuvo 27 años en prisión muchos de ellos en condiciones durísimas– da la impresión de que se comportase con la certeza de que un día saldría para tomarse la revancha.

Puede que esta combinación de infalibilidad más determinación sea la cualidad de los genios. Sin embargo, las personas que yo conozco personalmente no son así. Casi todas dan dos pasos hacia delante y uno hacia atrás. Se cansan, se deprimen (algunos psicólogos afirman que la depresión es un mecanismo defensivo para dejar de hacer cosas que no conducen a ninguna parte). Incluso a los emprendedores más exitosos y curtidos que me he encontrado me confesaron que les costaba llegar a su propio nivel. Tenían una vida más similar a la de esos artistas que lo mismo un año ganan un Oscar que al siguiente están en tratamiento de desintoxicación alcohólica. Voy a intentar enumerar lo que he podido aprender de algunos campeones, y cómo sobreviven a las tempestades con algo más que únicamente su propia determinación.

Sobreasignación

Uno de mis consejos favoritos y que más me divierte repetir es la Regla Nº1 del Gasto Militar: Nunca compres un tanque si puedes comprar dos por el doble de precio. Esto se puede aplicar a casi todo en la vida, si te lo puedes permitir, claro. Tener exceso de stock puede salvar a la empresa de una crisis en los proveedores o servir para aprovechar la oportunidad de un pico inesperado de demanda. También puede ser una forma de perder muchísimo dinero en obsolescencias.

Además de su coste, el inconveniente de la sobreasignación es que resulta difícil determinar el umbral de seguridad. La gente tiende a pensar que si el requerimiento normal es X entonces una sobreasignación prudente será 2X o 3X. Pero las sobreasignaciones eficaces con frecuencia son 10X o más. Los analistas de riesgo tienden a crear el “peor escenario” en función de la peor crisis conocida en el pasado. La falacia de esta hipótesis del “peor escenario” es que cada crisis pasada fue peor que la peor de las anteriores. Debido a esta creencia errónea de que el futuro nunca será peor que el pasado es por lo que revientan centrales nucleares como Chernobil y Fukushima.

La sobreasignación ya fue descrita por Tsung Tzu en su clásico Arte de la Guerra en lo que él denominaba “lento, lento, rápido, rápido”. Prepararse a conciencia durante el tiempo que haga falta y luego atacar con la velocidad de un relámpago en el momento oportuno.

Anticoraje

El sistema de start ups funciona creando un gran número de ellas de las cuales tanto como el 80% o el 90% muere antes de alcanzar los cinco años de vida. Los inversores lo saben, y les da igual porque ellos juegan apostando sobre el resultado estadístico promedio y no sobre una única empresa. Pero para el emprendedor la media es irrelevante. Existe el mito de que los emprendedores son personas que asumen riesgos. Esto es una idea equivocada del emprendizaje. Los que asumen riesgos innecesarios sólo son estúpidos e imprudentes. Los mejores emprendedores trabajan eliminando riesgos. Empiezan con una situación de gran incertidumbre y trabajan sistemáticamente para reducirla.

Si uno lee los consejos de billonarios con Warren Buffet es fácil encontrar entre los primeros consejos que antes de pensar en cómo ganar dinero hay que pensar en cómo no perderlo. La táctica habitual de los inversores es colocar el 80% de su capital en activos de muy bajo riesgo y el otro 20% en activos de muy alto riesgo. De esta forma si pierden nunca pierden más del 80% pero si ganan entonces obtienen grandes beneficios. La pega es que si todo el mundo hace lo mismo, los activos de bajo riesgo dejan de ser tales por la cantidad brutal de deuda a quienes los emite, y los juegos de azar con nuevos proyectos adquiren una probabilidad ínfima de ganancia. De hecho, la estrategia exitosa de Warren Buffet no fue esta del 80%-20% sino apostar fuerte y a medio-largo plazo por activos conyunturalmente devaluados.

Blindaje

El blindaje está relacionado con la sobreasignación y con el anticoraje, pero se extiende más allá de los recursos económicos o la evaluación de riesgos. Consiste en una protección a priori contra algo de lo que, en principio, no parece necesario protegerse. El blindaje sólo es eficaz si se instaló antes de que se produjese la catástrofe y la parte contraria desconoce su existencia pues en otro caso pensará en la forma de perforarlo.

La protección que más a menudo olvidan los emprendedores es aquella contra sus propios socios. Este blindaje es complicado porque requiere generar una situación de confianza que en realidad no existe. Sin confianza entre los socios no se puede llevar adelante un negocio, pero con confianza ciega tampoco por el hecho de la antireputación que comentaré más adelante.

Pocas si acaso alguna start up se constituye con un plan de contingencia para el caso en que la empresa quiebre. Lo cual es estúpido y temerario si se tiene en cuenta que estadísticamente el resultado más probable de una start up es el cierre por insolvencia.

Compartimentalización

La compartimentalización es una forma de blindaje. Consiste separar partes del sistema de modo que una catastrofe en una no destruya las demás. Esto casi nunca es sencillo de conseguir y las ideas modernas sobre la conciliación no ayudan en nada. Es complicadísimo competir por una medalla olímpica sin poner en serio riesgo la salud, pretender ser elegido presidente sin que sufra la vida familiar, obtener un préstamo sin tener que avalarlo personalmente o subir al Everest sin riesgo de morir por cansancio e hipotermia. La compartimentalización es uno de los desafíos más difíciles del campeón. Al actor Will Smith se lo escuché una vez enunciado como: “Si eres de esas personas que luchan por el 99% eso está bien, quédate en casa y sé feliz”. Muchos emprendedores no compartimentalizan, sólo queman sus naves como Hernán Cortés en el deseo de triunfar o morir en el intento. Esta falta de prudencia no es muestra de ninguna sabiduría especial. Los que sobreviven lo hacen sólo por pura suerte lo mismo que no todos los que en una batalla corren colina arriba en dirección a las ametralladoras mueren a causa de la balacera, sino que en cantidades numerables con los dedos de una mano vuelven para recibir una medalla y quizá un monumento a su insensatez en la plaza de su pueblo.

Antirreputación

Si te preocupa lo que la gente piense de ti es mejor que no te metas a político ni a emprendedor. Algunas profesiones como médico, juez o militar no admiten pérdidas de reputación. Por eso ni médicos ni jueces ni militares van por libre sino que están estrictamente regulados. Pero no es el caso de los emprendedores. Obama trató recientemente de descalificar a Donald Trump argumentando que conocía muchos empresarios tan exitosos como él, pero que no habían dejado a su paso un reguero de despidos, impagos y gente cabreada. Pues bien, es imposible ser emprendedor de éxito sin cabrear a alguien. Por dos motivos: 1º) un porcentaje significativo de las victorias se obtienen tras una acción audaz (y a veces no muy limpia) contra el adversario, y 2ª) una buena forma de construir un sistema resistente es con piezas débiles pero redundantes y reemplazables. Esto se aplica lo mismo a un centro de datos que opera sobre discos baratos que a una empresa que opera sobre mano de obra barata, excepto que las personas tienen derechos y sensibilidades bien diferentes a los de los discos. Hasta la fecha no ha funcionado en la práctica ningún sistema social basado en que nadie pueda fallar y quedarse por el camino. Existe una creciente preocupación por la solidaridad y la cohesión social pero a la postre cualquiera es prescindible.

Por otra parte, para tener éxito en muchas ocasiones el número de detractores no cuenta. Importa mucho más tener un pequeño grupo de seguidores fanáticos (Jesucristo tenía al principio sólo 12). Si los fanáticos son lo bastante activos e influyentes persuadirán a la masa indiferente y los destrozos denunciados por los detractores se verán eclipsados a los ojos de la mayoría.

Hasta las mejores causas tienen grupos opositores como el de los Trabajadores Inocentes que Murieron en el Ataque a la Estrella de la Muerte. Y diré más, en los negocios cuanto mayor es la reputación de una persona menos hay que fiarse de ella, pues sobre las personas de reputación incuestionable se relajan los controles que serían necesarios hasta tal punto que cuando la sociedad se da cuenta del desastre que han causado ya es demasiado tarde para arreglarlo.

Adrenaholismo

En psicología se sabe que una persona puede volverse adicta a casi cualquier cosa. Muchos emprendedores son adictos a la adrenalina y al cortisol hasta el punto de que no saben qué hacer con sus vidas cuando están relajados. Oficialmente sueñan con retirarse y descansar pero en la práctica no dejan de meterse en un lio detrás de otro. Personalmente creo que algunas personas tienen una resistencia natural extraordinaria a determinadas substancias. Puede que soporten la adrenalina o los esteroides de una forma que les permite obtener una ventaja competitiva sobre quienes simplemente no pueden tolerar dosis elevadas de dichos estimulantes en su sangre.

No hay que confundir la adicción a la adrenalina con la addición a trabajo. Muchas personas adictas al trabajo lo son precisamente por la causa contraria: a duras penas soportan su vida fuera del entorno laboral. Estas personas adictas al trabajo pueden ser buenos trabajadores y profesionales de éxito pero rara vez triunfan como emprendedores.

Sobrecompensación

El ejemplo más fácil sobrecompensación es el fisioculturismo. Los profesionales no entrenan 8 o 10 horas al día. Esto agotaría al organismo. Lo que hacen es entrenar con una intensidad brutal durante cortos periodos de tiempo y luego le dan al cuerpo gran cantidad de tiempo y comida para recuperarse. El truco consiste en evitar la exposición prolongada al desgaste de manera que sea posible acumular energía para vencer de forma rápida y demoledora a los que están más cansados, cuando se presente la ocasión.

Simetría de pérdidas y ganancias

Es indeseable para el individuo una situación en la que tiene potencialmente mucho que perder pero poco que ganar. Paradójicamente este puede ser el caso de los muy ricos, los cuales a duras penas pueden enriquecerse más, pero podrían arruinarse en cualquier momento y esa idea imaginaria que les causa un stress insoportable. Fue por esto que Séneca –uno de mis filósofos favoritos– abogó por el estoicismo a pesar de ser él mismo una de las personas más ricas e influyentes del Imperio Romano de su tiempo. La solución es deshacerse de aquello que le hace a uno dependiente lo cual puede ser la propia riqueza de la que se ha caído prisionero. Es por esto que muchos multimillonarios se han desecho de buena parte de su fortuna después de obtenerla, aunque sinceramente todavía estoy esperando encontrar alguno que haya regalado el Ferrari.

Una de las características de la juventud es que en un momento dado de ella uno sufre una epifanía y cree saber hacia dónde se dirige. En realidad el iluminado no tiene ni puñetera idea pero da igual porque los que le siguen tampoco. Cristobal Colón creía que iba a llegar a la India. E igual que Colón casi todo el mundo llega a alguna parte pero casi nadie a donde pensaba que iba a llegar. Se dispara entonces un proceso de revisión crítica en el cual uno se percata de dos hechos irrefutables: 1º) cualquier conocimiento que se crea tener es sólo una burda aproximación a la realidad y 2º) el resto de los presunto expertos tampoco tienen ni putidea de lo que se traen entre manos. Con frecuencia esto se produce tras un merecido batacazo en el cual el galardonado director de cine, por poner un ejemplo, obtiene financiación para hacer la que será su obra cumbre pero con la que en los cines no consigue tras el estreno ni recuperar los costes de producción. Entonces, y sólo entonces, es cuando empieza a cuestionarse si realmente sabe algo acerca de lo que le interesa a la audiencia. La pérdida de fé consecuencia del aumento del conocimiento es extraordinariamente nociva para el emprendizaje, ya que, como hemos enunciado anteriormente, el funcionamiento del sistema depende de la inconsciencia del peligro entre los individuos jóvenes y aguerridos.

Conclusiones

Mi opinión personal es que la capacidad para mantener una trayectoria exitosa está más relacionada con la habilidad para alejarse de lo nocivo y acumular fuerzas que con la capacidad de esforzarse y superar adversidades. Se trata de conservar en todo momento la iniciativa bélica. De luchar siempre por conquistar algo y nunca por preservar algo conquistado. Incluso si se acaba en prisión, como Mandela, usar esta circunstancia como arma arrojadiza contra el enemigo, acusándole de tirano y abusón, aunque la pena de cárcel haya sido por cargos de terrorismo y conspiración para derrocar al Estado.

Creo que algunos campeones empezaron con buen pie y luego tuvieron suerte. Lo bueno de los éxitos empresariales es que sólo necesitas un grán éxito para poder vivir de sus réditos el resto de tus días. Luego puedes fallar todas las veces que quieras.

De lo que no conozco tantos casos es de personas que lo volviesen a intentar tras fallar miserablemente en su primer intento. Existen excepciones, por supuesto, hay notables hunde-empresas en serie. Personas que quebraron una empresa (normalemente con el dinero de un tercero) y luego otra, y otra, y otra… por aquello de que de los fracasos se aprende, entonces la próxima será la vencida, y así sería de no ser porque son personas que no aprenden sino que simplemente superan el fracaso con indolencia debido a una percepción distorsionada de la realidad que les permite atribuir la culpa siempre a algo o alguien diferente de sí mismos.

Mi argumento es que la victoria es una espiral hacia arriba y la derrota es una espiral hacia abajo y lo único que importa es la tendencia al alza o a la baja.

La resistencia sí que importa pero no tanto porque los individuos se fortalezcan por sobrecompensación con lo que no les mata sino porque los más débiles se quedan por el camino y al final sólo llega uno que es quien fué más hábil en administrar sus energías sin derrocharlas en empresas estériles.

Posts relacionados:

Combatiendo a tus dragones.
Pírricas Victorias Empresariales.
Saṃsāra corporativo y stress del emprendedor.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Emprendizaje | Deja un comentario

Los adolescentes en las redes sociales

Adolescentes en redes socialesExisten no pocos padres preocupados por las relaciones de sus hijos a través de las redes sociales. Frente a mi casa hay un bonito parque con varios rincones secretos encantadores. Bueno, secretos excepto cuando miras desde mi ventana en un tercer piso. Entonces puedes ver a los adolescentes allí haciendo todas las cosas que sus padres no quieren que hagan. Existen adolescentes que no soportan relacionarse en persona con el mundo. Pero la mayoría de los adolescentes prefieren verse en persona, como los de mi parque. Si están a las once de la noche enganchados al móvil es sólo porque sus padres les obligaron a volver a casa a las diez. Las motivaciones humanas no cambian con la introducción de nuevas tecnologías, sólo encuentran nuevas formas de satisfacerse.

Uso de redes sociales en adolescentesSegun los estudios, algo así como el 72% de los adolescentes tienen cuenta en Facebook. Entre un 40% y un 50% usan Snapchat. Las cifras para Twiter varían mucho según la fuente, entre un 8% y un 33%. Y la cifra de 33% para Google+ no me la creo, excepto porque como efecto secundario de abrir una cuenta en GMail Google puede abrirte un perfil en Google+.

Nativos (e inexpertos) digitales

No hay que caer en el error de presuponer que porque un jóven haya nacido con un smartphone debajo del brazo automáticamente sabrá cómo hacer un uso mejor de él que un adulto. Debido a la vertiginosa velocidad del progreso, las nuevas tecnologías siempre preceden a las buenas prácticas de uso de las mismas. Un adolescente con un móvil sigue siendo igual de ingénuo y vulnerable que si móvil y puede perfectamente cometer el error de hacer un uso pésimo de la tecnología a su alcance.

Contexto y audiencia

Una de los primeros desafíos a los que se enfrentan los adolescentes en las redes sociales es la falta de visibilidad sobre la audiencia a la que se están dirigiendo. Si están en el parque pueden fácilmente cambiar de conversación –o apagar la yerba– cuando ven de lejos acercarse a un adulto. Pero en las redes sociales nunca pueden estar seguros de quién les estará leyendo, y los adolescentes casi siempre se traen algo entre manos de lo que no quieren que los adultos se enteren. Este es uno de los motivos –hay más– por el cual los críticos de Facebook dicen que está perdiendo tracción entre los adolescentes y por el cual Facebook trató de comprar Snapchat por 3.000 millones de dólares en noviembre de 2013 para captar a los millennials.

El problema de la audiencia no afecta sólo a los adolescentes, por supuesto. A los adultos también les afecta. A pesar de que Mark Zuckerberg declarase que Facebook quiere ayudar a sus usuarios a quitarse la máscara, la realidad es que la red social decide por su cuenta qué contenidos mostrar a cada usuario y censura lo que le aparece oportuno; incluyendo, por ejemplo, unos pechos femeninos, es decir, si te va el top-less playero y compartir fotos con tus amigos naturistas o hacerte fotos con una copa de vino en la mano, entonces Facebook no es para ti.

El desdoblamiento de personalidad digital es un problema no resuelto en las redes sociales. Existe, en mi opinión, una obsesión excesiva en las redes sociales por desvelar la identidad real del usuario. Esto es hasta cierto punto comprensible por razones de seguridad. Es razonable que debido a que la red social y el usuario firman un contrato de uso, ese contrato sólo puede ser válido si es posible identificar a ambas partes. Lo que no se sigue de forma inmediata es por qué la red debería informar al resto de los usuarios sobre la identidad real de cada uno. No es necesariamente malo que las personas usen avatares. Tampoco implica que tengas una personalidad múltiple. Una persona puede tener cuenta en Facebook y en LinkedIn y en Twitter y en Instagram y mostrará en cada una aspectos diferentes de si misma. También podría tener más cuentas en redes donde pueda expresar su fervor religioso o su orientación sexual sin ofender a ningún idiota. Algunas personas necesitan escapar temporalmente de la realidad porque dicha realidad es verdaderamente asfixiante. En estos casos los avatares pueden tener un uso terapéutico permitiendo a la persona acercarse libremente a lo que quiere ser.

Gamers y espacios propios

Merecen una mención aparte las interacciones sociales que se producen entre los jugadores de videojuegos (gamers) especialmente los MMOG (Massively Multiplayer Online Game). Cuando la gente habla de redes sociales piensa en Facebook o en Twitter, pero en los MMOGs también se produce una intensa interacción social. No todos los jugadores de videojuegos son en absoluto el arquetipo de muchacho gordito y tímido, hay hombres y mujeres de todas las edades y tipos. Tampoco es cierto que siempre diseñen avatares diferentes de ellos mismos. En ocasiones el avatar no tiene nada que ver con el usuario pero algunos jugadores diseñan avatares que son lo más parecidos a como son ellos mismos en la realidad. Una característica diferencial de los MMOGs es la forma en la que permiten crear un espacio propio. En Facebook los usuarios están avocados a interactuar con personas que conoces de acuerdo a las normas de su comunidad. En Twitter pueden buscar grupos de interés no locales e interactuar por afinidad cultural en lugar de por proximidad. Pero en un MMOG las posibilidades de alterar el entorno y crear una dinámica grupal propia son prácticamente ilimitadas. Las interacciones entre los jugadores pueden llegar a ser muy complejas requiriendo colaboración múltiples para pelear o alcanzar determinados objetivos. Los MMOG tampién pueden propiciar la convocatoria de encuentros presenciales. Según un estudio de Nicholas Yee el 15% de los varones y el 5% de las féminas quedan en alguna ocasión para conocerse en persona lo cual a mi me parece un porcentaje elevado teniendo en cuenta que no existe limitación geográfica, en principio, para la residencia del jugador.

Intimidad

La disponibilidad de nuevas tecnologías desde edad muy temprana ha causado que para los adolescentes sea natural hablar de temas íntimos a través del chat. Los adultos piensan que los temas delicados hay que tratarlos siempre en persona –si son muy delicados de hecho no sólo en persona sino en una sauna todos en pelota picada para que nadie lleve micros–. Pero los adolescentes perciben que el smartphone es un medio más para comunicarse como otro cualquiera, y de ahí el éxito de las conversaciones de Snapchat que se autodestruyen tras ser leídas.

Uso pervasivo del móvil

Una diferencia entre adultos y adolescentes es que esto últimos han crecido con el móvil. Para ellos atenderlo es algo tan natural escuchar la radio mientras cocinas, es decir, con frecuencia no le están realmente prestando demasiada atención. Esto contrasta con el uso típico que le dan los adultos quienes bien están absortos con el celular bien lo tienen boca abajo en la mesa con el timbre en modo silencio. Para los adolescentes es normal ver un partido mientras chatean.

Necesidad de aceptación social

El objetivo social de los adolescentes casi siempre es parecer “molones” en el entorno adecuado. Era así en los bailes de fin de curso de antaño donde para las chicas era cuestión de vida o muerte llevar el vestido adecuado. Y sigue siendo exactamente lo mismo en las redes sociales. Todo va de “molar”, ser cool, tener flow.

Esta necesidad de aceptación se manifiesta en dos interacciones fundamentales en las redes sociales: quien hace clic en 👍 Me Gusta y quien escribe comentarios. Entre los adolescentes la competición por ver quién obtiene más Likes y, por consiguiente, es más molón, puede acarrear una presión insoportable para los menos populares, especialmente entre las chicas. Respecto de los comentarios, en general, a ningún usuario le gusta descubrir que le ha leído alguien que no esperaba y, además, ha puesto un comentario que va en contra de su opinión o resulta vergonzante. Pero si además la redactora del comentario es la hermana mayor o la madre eso puede suponer para el adolescente la muerte por vergüenza y cabreo por falta de netiqueta. En general, lo que a nadie le gusta en las redes sociales es perder el control de una conversación que ha iniciado, lo cual es fácil si existe un grupo organizado de bullies.

Privacidad

La privacidad de los adolescetes require de un compromiso prácticamente inalcanzable. Por una parte todos, absolutamente todos los adolescentes quieren privacidad. Aunque no estén haciendo nada malo, a ninguno le gusta que los adultos metan las narices en sus asuntos. Por otra parte los tutores tienen no sólo el derecho sino también la obligación de estar al corriente de lo que están haciendo los menores de edad en tanto en cuanto son responsables legalmente de ellos.

Otro asunto peliagudo es el relacionado con publicar fotografías de menores sin su consentimiento. Personalmente opino que lo mejor es no publicar nunca fotografías de terceras personas en Facebook. Para compartir fotos hay sitios mejores como Flickr donde se pueden designar personas autorizadas y compartir sólo con ellas las imágenes.

Cyberbullying

El bullying es uno de los aspectos más controvertidos y creo que al mismo tiempo peor entendidos de las relaciones sociales en niños y adolescentes. No existe un acuerdo total acerca de lo que es bullying pero, en general, se acepta que se da cuando en una dinámica confluyen tres factores: agresión, repetición y desequilibrio de poder físico o psicológico.

Recientemente, algunos estudios han mostrado que el cyberbulling es un fenómeno mucho más frecuente entre chicas. Con un 70% de víctimas acosadas por otras chicas. Mientras que en el bullying físico sólo el 47% de las víctimas son mujeres.

El bullying frecuentemente no es considerado con la suficiente seriedad por el claustro y la dirección de muchos colegios. O a veces todo lo contrario, en una política de tolerancia cero se vuelven todos locos si se produce un caso. Además, yo personalmente opino que la teoría moderna de la víctima, el agresor y los testigos es incompleta y probablemente incluso inapropiada como remedio. Según esta teoría (que algunos afirman que tiene resultados milagrosos) la clave para erradicar el bullying consiste en hacer a los espectadores conscientes de su contribución pasiva a la agresión y, una vez que se han dado cuenta, moverles a actuar en grupo para prevenir ataques del agresor. Esta teoría falla por tres lados: 1º) no explica nada acerca de las causas originarias de la agresión, 2º) da por sentado que la agresión es de un individuo a otro cuando de hecho puede que todo el grupo sea el agresor, y 3º) pone sobre un grupo de niños o adolescentes el peso de una responsabilidad preventiva que posiblemente no estén preparados para asumir.

Las políticas de uso de las redes sociales no tienen medidas específicas contra el bullying. Las sugerencias contra el acoso de Facebook básicamente dicen que si alguien te está atacando bloquees su cuenta y ocultes sus actualizaciones. Pero ¡rayos! si eres un adolescente ¿qué haces? ¿ocultas a toda tu clase y te das de baja de la red? Según los community standards también es posible denunciar al agresor y su comportamiento “no será tolerado”, aunque no me queda claro qué implica “no tolerar” más allá de borrar algún comentario o foto.

Las causas del bullying suelen encontrarse en problemas familiares en la casa del agresor, stress, afán de poder, personalidad desordenada, complejo de superioridad o simple placer sádico en el caso de que el bully sea un sociópata, pero la gran mayoría de los bullies no son sociópatas sino las primeras víctimas de sí mismos. Además, el agresor es sólo uno de los implicados, el otro es la víctima quien también puede tener su propio conjunto de problemas que la hagan vulnerable a los ataques: inseguridad, vergüenza, segregación racial, limitaciones físicas, etc. Si no se actua sobre estas causas originarias del bullying entonces el cambio en la dinámica grupal es sólo un remedio sintomático.

El bullying tampoco es sólo un niño quitándole el bocadillo a otro todos los días en el patio. Muy frecuentemente toma la forma de rumores, risitas encubiertas, motes y comentarios jocosos sobre el acosado en los que participa una pandilla entera. Las personas, jóvenes y adultos, se envalentonan y se vuelven más agresivas en masa, entonces el bullying se produce por una dinámica de grupo y no por acción aislada de un individuo. En algunas ocasiones el acosado incluso puede asumir el papel de payaso del grupo y aceptar las vejaciones porque eso le proporciona cierta forma de protagonismo.

Las redes sociales implican, no obstante, buenas noticias para los defensores de la teoría de la víctima el agresor y los espectadores. En la red lo que ha sucedido es visible y perdura. Por consiguiente, fijar los hechos y mostrar lo que ha pasado es más fácil que tras una agresión verbal de la que no ha quedado ninguna constancia fidedigna excepto por las versiones diversas de los testigos.

Drama

Una peculiaridad de los adolescentes que rara vez se da entre los adultos –o al menos yo no la he encontrado en primera persona– es el drama. Los adolescentes pueden organizar una representación dramática para llamar la atención y obtener popularidad.

Peligros online

Por último, me he dejado premeditadamente en el tintero y no quiero entrar a comentar el tema de los peligros online: pederastas, timadores, ladrones, etc. Cualquier sociedad es más peligrosa de lo que debería y el ciberespacio no es diferente. “Cómo protegerse online” podría ser el título de otro post entero además de que no me queda claro si hay sólo que proteger a los adolesentes o también protegerse de ellos.

Posts relacionados:

Cómo y porqué la gente se vuelve adicta al móvil.
Cómo Internet modifica nuestras capacidades intelectuales y sociales.
Sobre la dinámica social en los sitios de dating.

Compartir:
  • Twitter
  • Meneame
  • Facebook
  • Google Buzz
Publicado en Usos sociales de la tecnología | Deja un comentario